[mira_talk] Re: Vector screen
- From: hikaru <hsuenaga@xxxxxxxxxxxxx>
- To: mira_talk@xxxxxxxxxxxxx
- Date: Tue, 15 Mar 2011 18:04:43 +0100
On 03/14/11 17:44, Bastien Chevreux wrote:
> Probably yes. You used SSAHA2 and SMALT? You are the second person I know of
> to do that ... and I'm not sure how undefined the state is when MIRA
> encounters
> that (see it as a buggy feature which will be removed from future releases).
>
> To cut things short: do not use SSAHA2 for this task anymore. It was a
> makeshift and the author itself does not recommend doing that. Go with SMALT
> (and remove all SSAHA2 output files from the MIRA working directory).
>
> Once you have done that and re-ran the assembly, check whether there are
> still
> vector/adaptor remnants. These could be due to two sources: error in SMALT
> (something which was not recognised) or error in MIRA (wrongly interoreted
> SMALT results). To check for that, it will be important to find out exatly
> what
> happened. For that, have a look at the contigs with contaminant in an
> assembly
> finishing tool (gap4, gap5 or consed) and find the read which has the
> contaminant not clipped. Then look at the SMALT result file whether it is
> masked there. If not: SMALT problem: if it is: MIRA problem.
>
> In both cases: please report back to the list what you find out so that we
> can
> have a look on how to proceed best.
>
> Best,
> Bastien
Hello, Bastien
Thank you for your suggestion. According to your suggestion, I re-ran
the assembly with SMALT and check the vector remnants. As a result, it
seems that produced contigs still contain vector sequence and this is
from MIRA problem.
Below is a extraction of each run results.
>SMALT_result
alignment:S:00 70 GJMJG5A02F1HEX pCC1Fos 16 85
8070 8139 F 70 100.00 524
(SMALT certainly recognizes the vector region in GJMJG5A02F1HEX read.)
>GJMJG5A02F1HEX_sequence (a part of full length)
gactacactactcgtTGAACAATGGAAGTCCGAGCTCATCGCTAATAACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAGGGGTTCGCGTCAGCGGGTGTTGG
(capital sequences indicates vector regions)
>MIRA_result
-------------- Contig statistics ----------------
Sequence:
0 | . | . | . | . | . | .
GJMJG5A02F1HEX+
CAATGGAAGTCCGAG
GJMJG5A02HXZHF+
CAATGGAAGTCCGAG
------------------------------------------------------------
Consensus:
GCCTCTGTCGTTTCCTTTTCTTCTGTTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAG
60 | . | . | . | . | . | .
GJMJG5A02F1HEX+
CTCATCGCTAATAACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCA
GJMJG5A02HXZHF+
CTCATCGCTAATAACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCA
------------------------------------------------------------
Consensus:
CTCATCGCTAATAACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCA
(MIRA results still contained GJMJG5A02F1HEX sequence)
These are in log file.
Merging vector screen data from SMALT results file
AOMppool03_RAW_smaltvectorscreen_in.txt:
[0%] ....|.... [10%] ....|.... [20%] ....|.... [30%] ....|.... [40%]
....|.... [50%] ....|.... [60%] ....|.... [70%] ....|.... [80%]
....|.... [90%] ....|.... [100%]
Done merging SSAHA2 vector screen data.
Best regards,
Hikaru
Other related posts:
