[mira_talk] Re: MIRA: I am doing it wrong.
- From: Alessandro Riccombeni <rikkomba@xxxxxxxxx>
- To: mira_talk@xxxxxxxxxxxxx
- Date: Tue, 22 Dec 2009 15:47:59 +0000
OK, I got more info, as I directly spoke with the person that provided the
sequences.
It was done at 10x coverage and they used Newbler to get 39 scaffolds from
this.
I got the library sizes and standard deviations.
I am trying to use sff_extract with the titanium linker sequences.I put both
the titanium sequence and its reverse complement in the linker.fasta file,
but sff_extract says:
sequence 'titlinker2' present multiple times. Aborting.
How do I use sff_extract with two sequences? I don't get an error for the
first sequence.
My linker.fasta only includes:
>titlinker1
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
>titlinker2
CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
On Thu, Dec 10, 2009 at 6:15 PM, Bastien Chevreux <bach@xxxxxxxxxxxx> wrote:
> On Mittwoch 09 Dezember 2009 Alessandro Riccombeni wrote:
> > Sorry for being dumb. Yes, I just checked the Titanium adaptor and its
> > reverse complement and they are both present in my reads.
>
> Ummmm, adaptors are not the problem, these are masked by the Roche software
> (well, 99.9% of the time). What's important are the paired-end linkers, and
> Titanium uses _two_ of them (GS20 and FLX protocols used only one).
>
> Can you please try the following: download 'sff_extract' in
> http://www.chevreux.org/tmp/mira_3rdparty_10-12-2009.tar.bz2
>
> Then follow the walkthrough "Extracting paired-end data from SFF" in the
> 454
> usage manual of MIRA (currently it's
> http://mira-assembler.sourceforge.net/docs/mira_454.html#section_28
>
> Can you then please report back whether this fixes your problem?
>
> Regards,
> Bastien
>
> --
> You have received this mail because you are subscribed to the mira_talk
> mailing list. For information on how to subscribe or unsubscribe, please
> visit http://www.chevreux.org/mira_mailinglists.html
>
Other related posts:
