[mira_talk] Re: mid-tags

It should be possible to assemble tagged 454 reads using the existing tools.
More details following Bastien's last comment.

Bastien Chevreux wrote:
On Tuesday 17 February 2009 Oscar Franzén wrote:
I have a question about MIRA (great software by the way):
is it possible to assemble 454 data sequenced with MID-tags?

Hello Oscar,

yes and no. You must "remove" the MID tags from the input sequence as else they'd wreak havoc.

Assuming that in the following read

demo
tcag ttgccaggtaac ctcgattgagtactatctgacgagcgacgactgtctgcat

the "tcag" is the 'normal' remainder of the 454 adaptor (clipped away by sff_extract vie a corresponding left clip entry in the ancillary XML data) and "ttgccaggtaac" is one of your MID tags, you can:

1) physically remove the whole stretch (I do not recommend this), leading to
demo
ctcgattgagtactatctgacgagcgacgactgtctgcat

2) mask the MID tag (and perhaps also the remainder of the adaptor) and use -
CL:mbc
demo
xxxx xxxxxxxxxxxx ctcgattgagtactatctgacgagcgacgactgtctgcat

3) (prefered) keep the whole sequence as is and use a script that sets correct values in the XML file with ancillary data.

The problem with all three possibilities above: even though a number of people have inquired previously by mail regarding this topic, I yet haven't got back any script that performs this kind of data mangling[*]. Feel free to be the first :-)

Regards,
  Bastien

[*] I would assume that this belongs to "normal" data processing that the Roche software should perform, but until now this is not part of their software pipeline.


The program SSAHA (http://www.sanger.ac.uk/Software/analysis/SSAHA/) can screen your 454 reads for the presence of MID tag sequences, and produce an output file that can be read by MIRA using the *-CL:msvs* switch. These tools are intended for use in screening Sanger reads for the presence of sequencing vector, but with the appropriate parameter settings in SSAHA, it can find short sequences such as the MID tags as well. The risk is that any coincidental matches of the same sequence elsewhere in the read will be marked as "vector" and not used for assembly, but for 10-bp MID tags the frequency of such an artifact should be low. Key parameter settings for SSAHA are -pf -da 0 (required for MIRA to read the output file), and the -wl , -mg , -mi , and -sl parameters. For 10-bp MID tags, you could try -wl 10 -mg 1 - mi 1 -sl 1. To avoid assembling reads with different MID tags into the same contigs, you would use the bin_fasta_on_mid_primers.pl Perl script from the 3rdparty script package to sort the 454 reads into different files based on the presence of the MID tags, and assemble each set of reads independently. This would require running SSAHA on each of the input files, so that each input file has its own "vector clipping" information specific to the appropriate MID tag.

Regards,
Ross

--
Ross Whetten
Associate Professor
Dept of Forestry & Environmental Resources
NC State University Raleigh NC 27695-8008



--
You have received this mail because you are subscribed to the mira_talk mailing 
list. For information on how to subscribe or unsubscribe, please visit 
http://www.chevreux.org/mira_mailinglists.html

Other related posts: