[mira_talk] Re: mid-tags

Thanks for your answer. I solved it by writing a script that removes the 454 adaptor and the actual tag. 

Best,
oscar


Bastien Chevreux wrote:

On Tuesday 17 February 2009 Oscar Franzén wrote:

I have a question about MIRA (great software by the way):
is it possible to assemble 454 data sequenced with MID-tags?


Hello Oscar,
yes and no. You must "remove" the MID tags from the input sequence as else they'd wreak havoc. 

Assuming that in the following read


demo

tcag ttgccaggtaac ctcgattgagtactatctgacgagcgacgactgtctgcat
the "tcag" is the 'normal' remainder of the 454 adaptor (clipped away by sff_extract vie a corresponding left clip entry in the ancillary XML data) and "ttgccaggtaac" is one of your MID tags, you can: 

1) physically remove the whole stretch (I do not recommend this), leading to

demo

ctcgattgagtactatctgacgagcgacgactgtctgcat

2) mask the MID tag (and perhaps also the remainder of the adaptor) and use -
CL:mbc

demo

xxxx xxxxxxxxxxxx ctcgattgagtactatctgacgagcgacgactgtctgcat
3) (prefered) keep the whole sequence as is and use a script that sets correct values in the XML file with ancillary data.
The problem with all three possibilities above: even though a number of people have inquired previously by mail regarding this topic, I yet haven't got back any script that performs this kind of data mangling[*]. Feel free to be the first :-) 

Regards,
  Bastien
[*] I would assume that this belongs to "normal" data processing that the Roche software should perform, but until now this is not part of their software pipeline. 




--
You have received this mail because you are subscribed to the mira_talk mailing 
list. For information on how to subscribe or unsubscribe, please visit 
http://www.chevreux.org/mira_mailinglists.html

Other related posts: