[mira_talk] Re: mid-tags

  • From: Bastien Chevreux <bach@xxxxxxxxxxxx>
  • To: mira_talk@xxxxxxxxxxxxx
  • Date: Wed, 18 Feb 2009 14:59:58 +0100

On Tuesday 17 February 2009 Oscar Franzén wrote:
> I have a question about MIRA (great software by the way):
> is it possible to assemble 454 data sequenced with MID-tags?

Hello Oscar,

yes and no. You must "remove" the MID tags from the input sequence as else 
they'd wreak havoc.

Assuming that in the following read

tcag ttgccaggtaac ctcgattgagtactatctgacgagcgacgactgtctgcat

the "tcag" is the 'normal' remainder of the 454 adaptor (clipped away by 
sff_extract vie a corresponding left clip entry in the ancillary XML data) and 
"ttgccaggtaac" is one of your MID tags, you can:

1) physically remove the whole stretch (I do not recommend this), leading to

2) mask the MID tag (and perhaps also the remainder of the adaptor) and use -
xxxx xxxxxxxxxxxx ctcgattgagtactatctgacgagcgacgactgtctgcat

3) (prefered) keep the whole sequence as is and use a script that sets correct 
values in the XML file with ancillary data.

The problem with all three possibilities above: even though a number of people 
have inquired previously by mail regarding this topic, I yet haven't got back 
any script that performs this kind of data mangling[*]. Feel free to be the 
first :-)


[*] I would assume that this belongs to "normal" data processing that the 
Roche software should perform, but until now this is not part of their 
software pipeline.

You have received this mail because you are subscribed to the mira_talk mailing 
list. For information on how to subscribe or unsubscribe, please visit 

Other related posts: