[mira_talk] Re: Problems using sff extract
- From: Ganga Jeena <ganga.jeena@xxxxxxxxx>
- To: mira_talk@xxxxxxxxxxxxx
- Date: Tue, 14 Dec 2010 09:37:54 +0530
I am facing simialr issue with sff_extract. I downloaded SSAHA2 ver 2.5.3 ,
but It has no installation instructions, only programs ssaha2 ssaha2Build
and ssahaSNP.
Please explain, how did it work out for you?
Regards,
Ganga Jeena
On Tue, Dec 14, 2010 at 1:31 AM, Artemus Harper <subanark@xxxxxxxxx> wrote:
> Apparently I didn't have ssaha2 installed. It works now that it is
> installed.
>
>
> On Mon, Dec 13, 2010 at 7:07 AM, Cleo Ho <cleoho175@xxxxxxxxx> wrote:
>
>> I had the same problem before, and it turned out I didn't put ssaha2 in
>> the correct directory. ssaha2 should be put in place where mira can call it
>> directly by the its command line from any directory. Such directory may be
>> usr/local/bin, for example, in a Linux system. Hope this helps.
>>
>> Cleo
>>
>> On 2010-12-13, at 1:31 AM, Artemus Harper <subanark@xxxxxxxxx> wrote:
>>
>> The error message is exactly as I've posted. Thats all the info it gives.
>> It occurs after several seconds after starting.
>> On Dec 12, 2010, at 5:29 PM, Sven Klages wrote:
>>
>> When does the error occur, immediately? What does the error say?
>>
>> 2010/12/10 Artemus Harper < <subanark@xxxxxxxxx>subanark@xxxxxxxxx>
>>
>>> I'm trying to use sff_extract, but I ran into an error:
>>> $ sff_extract_0_2_8 -o cherry_454 -l linker.fasta -i
>>> "insert_size:8000,insert_stdev:750" 454_paired_end_8kb_reads/GQKO24N02.sff
>>> Working on '454_paired_end_8kb_reads/GQKO24N02.sff':
>>> Creating temporary sequences from reads in
>>> '454_paired_end_8kb_reads/GQKO24N02.sff' ... done.
>>> Searching linker sequences with SSAHA2 (this may take a while) ...
>>>
>>> An error occured during the SSAHA2 execution, aborting.
>>>
>>> My linker file is:
>>> >cherry_linker_1
>>> TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
>>> >cherry_linker_2
>>> AGCATATTGAAGCATATTACATACGATATGCTTCAATAATGC
>>>
>>> --
>>> Artemus Harper
>>>
>>
>>
>>
>
>
> --
> Artemus Harper
>
Other related posts:
