[mira_talk] Re: Problems using sff extract
- From: Artemus Harper <subanark@xxxxxxxxx>
- To: mira_talk@xxxxxxxxxxxxx
- Date: Sun, 12 Dec 2010 22:31:19 -0800
The error message is exactly as I've posted. Thats all the info it gives. It
occurs after several seconds after starting.
On Dec 12, 2010, at 5:29 PM, Sven Klages wrote:
> When does the error occur, immediately? What does the error say?
>
> 2010/12/10 Artemus Harper <subanark@xxxxxxxxx>
> I'm trying to use sff_extract, but I ran into an error:
> $ sff_extract_0_2_8 -o cherry_454 -l linker.fasta -i
> "insert_size:8000,insert_stdev:750" 454_paired_end_8kb_reads/GQKO24N02.sff
> Working on '454_paired_end_8kb_reads/GQKO24N02.sff':
> Creating temporary sequences from reads in
> '454_paired_end_8kb_reads/GQKO24N02.sff' ... done.
> Searching linker sequences with SSAHA2 (this may take a while) ...
>
> An error occured during the SSAHA2 execution, aborting.
>
> My linker file is:
> >cherry_linker_1
> TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
> >cherry_linker_2
> AGCATATTGAAGCATATTACATACGATATGCTTCAATAATGC
>
> --
> Artemus Harper
>
Other related posts:
