Hi! I was trying to write a small script to produce phdballs to use in consed... I started to use the input reads and qualities (fasta/qual) to produce fake phds and concatenate them. Was working fine but, darn, consed tells me that some nucleotides are inconsistent between the phd and the ace file... I did a bit a digging into the files, and indeed, some reads are edited during the assembly (I checked both ace and caf files). Same thing for the quality values, they change between the input files and the caf files... I also checked the tags, and it seems that the R454 tags correspond to such deletions (marked between underscores in the sequences below. What are the criteria that MIRA uses to decide to delete a nucleotide in a read? Wouldn't it be more appropriate to make gaps in the other sequences? Well, to produce the phdball I guess I have to start from the caf file... Cheers, Lionel caf: tcagTTTCCATTTGGTCTGGATCGATCGCACCTTGACGGTGATTCGCGCTTTATTAGACA ATATTCGGTCGCGCGCATGTTCACCATCGTAGATTCCGAAGAACTCTTGTTGAACAGCTG GTGCACTCAAAAGCGCTGTCGTGTCATAGTTCAACTGAATAGTATCATAGTCGTAGCTCT CACGGTTGAGCACATACTGATTAAGCCAGTATTTGTCTACAACTTCACCATAACTCGTTT CATGTTCACGCATTACCGAAATAGCATCGACTGCGCCGGTAGCGTTATCGACGCGCAGCA CCAA-GGGGTA-GGaggcgtggttgggtaaaaacccggtaacgtaaactacgacgcacgc tataccgagccaatccgaagactaacaagaccaaggcaccgcctcgtccgccaacgcggc gcgtgcgcgatttacgtaacttcgctgagactgccaaggccacgaccagggagtaggnng n fasta: tcagTTTCCATTTGGTCTGGATCGATCGCACCTTGACGGTGATTCGCGCTTTATTAGACA ATATTCGGTCGCGCGCATGTTCACCATCGTAG_G_ATTCCGAAGAACTCTTGTTGAACAGCT GGTGCACTCAAAAGCGCTGTCGTGTCATAGTTCAACTGAATAGTATCATAGTCGTAGCTC TCACGGTTGAGCACATACTGATTAAGCCAGTATTTGTCTACAACTTCACCATAACTCGTT TCATGTTCACGCATTACCGAAATAAGCATCGACTGCGCCGGTAGCGTTATCGACGCGCAG CACCAAGGGGTAGGaggcgtggttgggtaaaaacccggtaacgtaaactacgacgcacgc tataccgagccaatccgaagactaacaagaccaaggcaccgcctcgtccgccaacgcggc gcgtgcgcgatttacgtaacttcgctgagactgccaaggccacgaccagggagtaggnng n tags in caf file: Sequence : FR3I0X301A0PY0 Is_read Padded Template "FR3I0X301A0PY0" Strand Forward SCF_File "FR3I0X301A0PY0" Seq_vec SVEC 1 5 Seq_vec SVEC 315 481 Clipping QUAL 17 481 Align_to_SCF 1 92 1 92 Align_to_SCF 93 262 94 263 Align_to_SCF 263 304 265 306 Align_to_SCF 306 311 307 312 Align_to_SCF 313 481 313 481 Tag HAF3 29 309 "" Tag R454 91 92 "" Tag R454 262 263 "" Tag MINF 1 1 "ST=454" -- You have received this mail because you are subscribed to the mira_talk mailing list. For information on how to subscribe or unsubscribe, please visit http://www.chevreux.org/mira_mailinglists.html