[mira_talk] Re: 454 cleaning
- From: Bastien Chevreux <bach@xxxxxxxxxxxx>
- To: mira_talk@xxxxxxxxxxxxx
- Date: Tue, 30 Nov 2010 22:17:09 +0100
On Dienstag 30 November 2010 Robin Kramer wrote:
> It is hard to tell if SMALT is doing any better with those settings.
MIRA will probably not be of much help in deciding which filtering was better.
What you could do is: run the filtered library again through some search
program (BLAST or FASTA3) and count hits (above a certain threshold).
> I am wondering if MIRA is reconstructing noisy adapters, that the aligners
> aren't able to find, almost doing too good of a job being able to assemble
> even the faintest of adapter sequence signal.
*rotfl* That made my day.
> In any case the vector is still making chimera looking things by the
> cat
> SRR054580_Asha_assembly/SRR054580_Asha_d_results/SRR054580_Asha_out.unpadde
> d.fasta
>
> | seqs_filter_by_len -s 100 | grep AAGCAGTGGTATCAACGCAGAGTACGGGGG|wc -l
>
> 3498
> The adapter is highlighted in this chimera.
> CAACTCCAACGCATGAATGCCCTCAAGCAGTGGTATCAACGCAGAGTACGGG
> GGGTGGGTTCATGAGACATGGAACCCTA
Hmmm ... have you tried to track down how this sequence came to be? Just by
looking at this very contig in an assembly viewer ... gap4 or tablet? If need
to be, use "convert_project -f maf -t txt" (or even "-t html"). Is it two
reads with partial adaptors assembled or just one read with an adaptor not
found? In any case, you should then look up the SSAHA2 / SMALT hit files for
that read (those reads) to see what happened. Maybe they were found but the
SSAHA2 / SMALT filtering routines from MIRA were too strict in the parameters
and did not filter? that would be interesting (and important) to know, so that
I could take some countermeasures.
B.
--
You have received this mail because you are subscribed to the mira_talk mailing
list. For information on how to subscribe or unsubscribe, please visit
http://www.chevreux.org/mira_mailinglists.html
Other related posts:
