Hi Chevreux, The details of the los _assembly files are as under: ******************************************************************************* [Newton:psi00b HK44_assembly]$ vi log_assembly This is MIRA V3.4.0 (production version). Please cite: Chevreux, B., Wetter, T. and Suhai, S. (1999), Genome Sequence Assembly Using Trace Signals and Additional Sequence Information. Computer Science and Biology: Proceedings of the German Conference on Bioinformatics (GCB) 99, pp. 45-56. To (un-)subscribe the MIRA mailing lists, see: http://www.chevreux.org/mira_mailinglists.html After subscribing, mail general questions to the MIRA talk mailing list: mira_talk@xxxxxxxxxxxxx To report bugs or ask for features, please use the new ticketing system at: http://sourceforge.net/apps/trac/mira-assembler/ This ensures that requests don't get lost. Compiled by: bach Sun Aug 21 17:50:30 CEST 2011 On: Linux arcadia 2.6.38-11-generic #48-Ubuntu SMP Fri Jul 29 19:02:55 UTC 2011 x86_64 x86_64 x86_64 GNU/Linux Compiled in boundtracking mode. Compiled in bugtracking mode. Compiled with ENABLE64 activated. Runtime settings (sorry, for debug): Size of size_t : 8 Size of uint32 : 4 Size of uint32_t: 4 Size of uint64 : 8 Size of uint64_t: 8 Current system: Linux psi00a 2.6.18-194.17.1.el5 #1 SMP Wed Sep 29 12:09:22 EDT 2010 x86_64 x86_64 x86_64 GNU/Linux Parsing parameters: --project=HK44 --job=denovo,genome,accurate,454 Parameters parsed without error, perfect. -CL:pec and -CO:emeas1clpec are set, setting -CO:emea values to 1. ------------------------------------------------------------------------------ Parameter settings seen for: Sanger data (also common parameters), 454 data Used parameter settings: General (-GE): Project name in (proin) : HK44 Project name out (proout) : HK44 Number of threads (not) : 2 Automatic memory management (amm) : yes Keep percent memory free (kpmf) : 15 Max. process size (mps) : 0 EST SNP pipeline step (esps) : 0 Use template information (uti) : [san] yes "log_assembly" 486L, 22794C ********************************************************************************************************************** Regards, Archie -----Original Message----- From: FreeLists Mailing List Manager [mailto:ecartis@xxxxxxxxxxxxx] Sent: Thursday, April 12, 2012 1:14 AM To: mira_talk digest users Subject: mira_talk Digest V5 #65 mira_talk Digest Wed, 11 Apr 2012 Volume: 05 Issue: 065 In This Issue: [mira_talk] mira not assembling [mira_talk] Re: mira not assembling [mira_talk] =?utf-8?B?UmU6IFttaXJhX3RhbGtdIG1pcmEgIG5vdCBhc3 ---------------------------------------------------------------------- From: "Chauhan, Archana" <achauha1@xxxxxxx> Subject: [mira_talk] mira not assembling Date: Wed, 11 Apr 2012 18:10:35 +0000 Hi, I am using mira for the first time. I am trying to assemble my 454 unpaired and paired end reads with mira. I could successfully extracted the both the unpaired and the paired end data from respective . sff files. Now I am trying to run the assembly with following command: mira --project=HK44 --jobÞnovo,genome,454 >&log_assembly [Newton:psi00a data]$ sff_extract -o HK44 ../origdata/FPBW0DM01.sff Working on '../origdata/FPBW0DM01.sff': Converting '../origdata/FPBW0DM01.sff' ... done. Converted 617042 reads into 617042 sequences. [Newton:psi00a data]$ ls -l total 1108371 -rw-r--r--+ 1 achauha1 users 326954919 Apr 11 13:51 HK44.fasta -rw-r--r--+ 1 achauha1 users 957040435 Apr 11 13:51 HK44.fasta.qual -rw-r--r--+ 1 achauha1 users 103997244 Apr 11 13:51 HK44.xml [Newton:psi00a data]$ head -40 HK44.fasta | grep -v ">" | cut -c 1-30 tcagTGCCAGTGCTCGACCGAAGCGTCTGT tcagGTTGACTATTGAGTCGCCACCTGCGC tcagTGTCGAAATTGACCCCGGAACACACT tcagCGCTGCGCTTGGCAACTTGAGCGCTT tcagTTGCAGGGATCGCCCATGAAGCGCTT tcagCGCAGTAGATTGCGAGCATCAAGCAC tcagTGCCTTGTTCTGCTCGATGCGGTTCT tcagAGATGACTGCCATTCCTACCGCGACC tcagAATCCAGGTTCTTCGAATGGCAGAAT tcagTGCCTTGTTCTGCTCGATGCGGTTCT tcagTCGCCATGCTCATGCAATGCCGCGTC tcagGACCTTGGCATCCAGCGCGCCAAGGT tcagTGCCTTGTTCTGCTCGATGCGGTTCT tcagTTCAGGCCGAATCGAAGCATTGGGAC tcagGTCTTGGCGCCGTGCTTGCCGATGTG tcagCTGGTAGAGAAGCACGTGCCAAGGCA tcagTTCAGATCCGCTGGCGACAGCGGTCC tcagAAGTCCGGCTCCATCAGCAGCAGGCC tcagCGTCGCGCATCGCTGCAACGTTATCT tcagTTTTTATCGCTTTCGGTCAACGTAAA [Newton:psi00a data]$ cat ../origdata/linker.fasta >titlinker1 TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG >titlinker2 CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA [Newton:psi00a data]$ sff_extract -o HK44 -a -l ../origdata/linker.fasta -i "insert_size:3000,insert_stdev:900" ../origdata/GFW0S2V01.sff Working on '../origdata/GFW0S2V01.sff': Creating temporary sequences from reads in '../origdata/GFW0S2V01.sff' ... insert_size:3000,insert_stdev:900" ./origdata/GFW0S2V01.sff done. Testing whether SSAHA2 is installed and can be launched ... ok. Searching linker sequences with SSAHA2 (this may take a while) ... ok. Parsing SSAHA2 result file ... done. Converting '../origdata/GFW0S2V01.sff' ... done. Converted 263887 reads into 481730 sequences. [Newton:psi00a data]$ ls -l total 1743865 -rw-r--r--+ 1 achauha1 users 420393768 Apr 11 13:59 HK44.fasta -rw-r--r--+ 1 achauha1 users 1216785437 Apr 11 13:59 HK44.fasta.qual -rw-r--r--+ 1 achauha1 users 241659226 Apr 11 13:59 HK44.xml [Newton:psi00a data]$ mv HK44.fasta HK44_in.454.fasta [Newton:psi00a data]$ mv HK44.fasta.qual HK44_in.454.fasta.qual [Newton:psi00a data]$ mv HK44.xml HK44_traceinfo_in.454.xml [Newton:psi00a data]$ ls -l total 1834191 -rw-r--r--+ 1 achauha1 users 420393768 Apr 11 13:59 HK44_in.454.fasta -rw-r--r--+ 1 achauha1 users 1216785437 Apr 11 13:59 -rw-r--r--+ HK44_in.454.fasta.qual -rw-r--r--+ 1 achauha1 users 241659226 Apr 11 13:59 -rw-r--r--+ HK44_traceinfo_in.454.xml [Newton:psi00a data]$ cd ../assembly/ [Newton:psi00a assembly]$ mkdir [Newton:psi00a assembly]$ mkdir arc_041112 [Newton:psi00a assembly]$ ls arc_041112 [Newton:psi00a assembly]$ cd arc_041112/ [Newton:psi00a arc_041112]$ ln -s ../../data/* . [Newton:psi00a arc_041112]$ ls HK44_in.454.fasta HK44_in.454.fasta.qual HK44_traceinfo_in.454.xml [Newton:psi00a arc_041112]$ ls -l total 2 lrwxrwxrwx 1 achauha1 users 28 Apr 11 14:04 HK44_in.454.fasta -> ../../data/HK44_in.454.fasta lrwxrwxrwx 1 achauha1 users 33 Apr 11 14:04 HK44_in.454.fasta.qual -> ../../data/HK44_in.454.fasta.qual lrwxrwxrwx 1 achauha1 users 36 Apr 11 14:04 HK44_traceinfo_in.454.xml -> ../../data/HK44_traceinfo_in.454.xml [Newton:psi00a arc_041112]$ mira --project=HK44 --jobÞnovo,genome,accurate,454 >&log_assembly [Newton:psi00a arc_041112]$ mira --project=HK44 --jobÞnovo,genome,accurate,454 >&log_assembly [Newton:psi00a arc_041112]$ ls HK44_assembly HK44_in.454.fasta HK44_in.454.fasta.qual HK44_traceinfo_in.454.xml log_assembly [Newton:psi00a arc_041112]$ cd HK44_assembly/ [Newton:psi00a HK44_assembly]$ ls -l total 8 drwxr-xr-x+ 2 achauha1 users 2 Apr 11 14:06 HK44_d_chkpt drwxr-xr-x+ 2 achauha1 users 2 Apr 11 14:06 HK44_d_info drwxr-xr-x+ 2 achauha1 users 2 Apr 11 14:06 HK44_d_results drwxr-xr-x+ 2 achauha1 users 2 Apr 11 14:06 HK44_d_tmp [Newton:psi00a HK44_assembly]$ cd HK44_d_results/ [Newton:psi00a HK44_d_results]$ ls [Newton:psi00a HK44_d_results]$ ls -l total 0 [Newton:psi00a HK44_d_results]$ The assembly command creates following subdirectories in the directory "arc_04/11_12" but all are empty. It appears that mira is not assembling (as the command finishes in 2-3 sec only) but does not give any errors either. I am not able to figure out what is going wrong. I wd appreciate if you could guide me. Regards, Archie ------------------------------ From: Bastien Chevreux <bach@xxxxxxxxxxxx> Subject: [mira_talk] Re: mira not assembling Date: Wed, 11 Apr 2012 20:37:55 +0200 On Apr 11, 2012, at 20:10 , Chauhan, Archana wrote: > The assembly command creates following subdirectories in the directory > “arc_04/11_12” but all are empty. It appears that mira is not assembling (as > the command finishes in 2-3 sec only) but does not give any errors either. > > I am not able to figure out what is going wrong. I wd appreciate if you could > guide me. At first glance things should be working. Can you please post "log_assembly" for me to have a look at? B. ------------------------------ Date: 12 Apr 2012 04:28:12 -0000 Subject: [mira_talk] =?utf-8?B?UmU6IFttaXJhX3RhbGtdIG1pcmEgIG5vdCBhc3NlbWJsaW5n From: "Abhishek sharma" <abhishek_btbin@xxxxxxxxxxxxxx> send ur log file .... check out ur files are properly extracted From: "Chauhan, Archana" <achauha1@xxxxxxx> Sent: Wed, 11 Apr 2012 23:41:21 To: "mira_talk@xxxxxxxxxxxxx" <mira_talk@xxxxxxxxxxxxx> Subject: [mira_talk] mira not assembling Hi, I am using mira for the first time. I am trying to assemble my 454 unpaired and paired end reads with mira. I could successfully extracted the both the unpaired and the paired end data from respective . sff files. Now I am trying to run the assembly with following command: mira --project=HK44 --job=denovo,genome,454 >&log_assembly [Newton:psi00a data]$ sff_extract -o HK44 ../origdata/FPBW0DM01.sff Working on '../origdata/FPBW0DM01.sff': Converting '../origdata/FPBW0DM01.sff' ... done. Converted 617042 reads into 617042 sequences. [Newton:psi00a data]$ ls -l total 1108371 -rw-r--r--+ 1 achauha1 users 326954919 Apr 11 13:51 HK44.fasta -rw-r--r--+ 1 achauha1 users 957040435 Apr 11 13:51 HK44.fasta.qual -rw-r--r--+ 1 achauha1 users 103997244 Apr 11 13:51 HK44.xml [Newton:psi00a data]$ head -40 HK44.fasta | grep -v ">" | cut -c 1-30 tcagTGCCAGTGCTCGACCGAAGCGTCTGT tcagGTTGACTATTGAGTCGCCACCTGCGC tcagTGTCGAAATTGACCCCGGAACACACT tcagCGCTGCGCTTGGCAACTTGAGCGCTT tcagTTGCAGGGATCGCCCATGAAGCGCTT tcagCGCAGTAGATTGCGAGCATCAAGCAC tcagTGCCTTGTTCTGCTCGATGCGGTTCT tcagAGATGACTGCCATTCCTACCGCGACC tcagAATCCAGGTTCTTCGAATGGCAGAAT tcagTGCCTTGTTCTGCTCGATGCGGTTCT tcagTCGCCATGCTCATGCAATGCCGCGTC tcagGACCTTGGCATCCAGCGCGCCAAGGT tcagTGCCTTGTTCTGCTCGATGCGGTTCT tcagTTCAGGCCGAATCGAAGCATTGGGAC tcagGTCTTGGCGCCGTGCTTGCCGATGTG tcagCTGGTAGAGAAGCACGTGCCAAGGCA tcagTTCAGATCCGCTGGCGACAGCGGTCC tcagAAGTCCGGCTCCATCAGCAGCAGGCC tcagCGTCGCGCATCGCTGCAACGTTATCT tcagTTTTTATCGCTTTCGGTCAACGTAAA [Newton:psi00a data]$ cat ../origdata/linker.fasta >titlinker1 TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG >titlinker2 CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA [Newton:psi00a data]$ sff_extract -o HK44 -a -l ../origdata/linker.fasta -i "insert_size:3000,insert_stdev:900" ../origdata/GFW0S2V01.sff Working on '../origdata/GFW0S2V01.sff': Creating temporary sequences from reads in '../origdata/GFW0S2V01.sff' ... insert_size:3000,insert_stdev:900" ./origdata/GFW0S2V01.sff done. Testing whether SSAHA2 is installed and can be launched ... ok. Searching linker sequences with SSAHA2 (this may take a while) ... ok. Parsing SSAHA2 result file ... done. Converting '../origdata/GFW0S2V01.sff' ... done. Converted 263887 reads into 481730 sequences. [Newton:psi00a data]$ ls -l total 1743865 -rw-r--r--+ 1 achauha1 users 420393768 Apr 11 13:59 HK44.fasta -rw-r--r--+ 1 achauha1 users 1216785437 Apr 11 13:59 HK44.fasta.qual -rw-r--r--+ 1 achauha1 users 241659226 Apr 11 13:59 HK44.xml [Newton:psi00a data]$ mv HK44.fasta HK44_in.454.fasta [Newton:psi00a data]$ mv HK44.fasta.qual HK44_in.454.fasta.qual [Newton:psi00a data]$ mv HK44.xml HK44_traceinfo_in.454.xml [Newton:psi00a data]$ ls -l total 1834191 -rw-r--r--+ 1 achauha1 users 420393768 Apr 11 13:59 HK44_in.454.fasta -rw-r--r--+ 1 achauha1 users 1216785437 Apr 11 13:59 HK44_in.454.fasta.qual -rw-r--r--+ 1 achauha1 users 241659226 Apr 11 13:59 HK44_traceinfo_in.454.xml [Newton:psi00a data]$ cd ../assembly/ [Newton:psi00a assembly]$ mkdir [Newton:psi00a assembly]$ mkdir arc_041112 [Newton:psi00a assembly]$ ls arc_041112 [Newton:psi00a assembly]$ cd arc_041112/ [Newton:psi00a arc_041112]$ ln -s ../../data/* . [Newton:psi00a arc_041112]$ ls HK44_in.454.fasta HK44_in.454.fasta.qual HK44_traceinfo_in.454.xml [Newton:psi00a arc_041112]$ ls -l total 2 lrwxrwxrwx 1 achauha1 users 28 Apr 11 14:04 HK44_in.454.fasta -> ../../data/HK44_in.454.fasta lrwxrwxrwx 1 achauha1 users 33 Apr 11 14:04 HK44_in.454.fasta.qual -> ../../data/HK44_in.454.fasta.qual lrwxrwxrwx 1 achauha1 users 36 Apr 11 14:04 HK44_traceinfo_in.454.xml -> ../../data/HK44_traceinfo_in.454.xml [Newton:psi00a arc_041112]$ mira --project=HK44 --job=denovo,genome,accurate,454 >&log_assembly [Newton:psi00a arc_041112]$ mira --project=HK44 --job=denovo,genome,accurate,454 >&log_assembly [Newton:psi00a arc_041112]$ ls HK44_assembly HK44_in.454.fasta HK44_in.454.fasta.qual HK44_traceinfo_in.454.xml log_assembly [Newton:psi00a arc_041112]$ cd HK44_assembly/ [Newton:psi00a HK44_assembly]$ ls -l total 8 drwxr-xr-x+ 2 achauha1 users 2 Apr 11 14:06 HK44_d_chkpt drwxr-xr-x+ 2 achauha1 users 2 Apr 11 14:06 HK44_d_info drwxr-xr-x+ 2 achauha1 users 2 Apr 11 14:06 HK44_d_results drwxr-xr-x+ 2 achauha1 users 2 Apr 11 14:06 HK44_d_tmp [Newton:psi00a HK44_assembly]$ cd HK44_d_results/ [Newton:psi00a HK44_d_results]$ ls [Newton:psi00a HK44_d_results]$ ls -l total 0 [Newton:psi00a HK44_d_results]$ The assembly command creates following subdirectories in the directory “arc_04/11_12†but all are empty. It appears that mira is not assembling (as the command finishes in 2-3 sec only) but does not give any errors either. I am not able to figure out what is going wrong. I wd appreciate if you could guide me. Regards, Archie ------------------------------ End of mira_talk Digest V5 #65 ****************************** b��j��yǢ��m�+&j)[yƮ�쨹���r��y�h�����jY&j)b� b��h�)ߢ���*'�xh��,���&ޢ�����r��z�^jǯ�ȭ��i��0��^���Ɗ��h�jf��)��+-�f