[mira_talk] Re: SSAHA2 vector screen
- From: Andy <mirabilis@xxxxxxxxx>
- To: mira_talk@xxxxxxxxxxxxx
- Date: Sat, 27 Mar 2010 14:09:43 -0700
My apologies, I made a mistake when I was trying to read a huge fastq files
- there *is* an N at the beginning of the reads that gave the error:
Error! The length of read SOLEXA1_0001:1:74:16647:1029#0/1 (101) does not
match the length given in the SSAHA2 file (101)
SSAHA2 line: ALIGNMENT::08 27 SOLEXA1_0001:1:74:16647:1029#0/1 pFLC-I 29 2
735 762 C 28 100 101
Error! The length of read SOLEXA1_0001:1:74:17068:1020#0/1 (101) does not
match the length given in the SSAHA2 file (101)
SSAHA2 line: ALIGNMENT::50 100 SOLEXA1_0001:1:74:17068:1020#0/1 pCMVSPORT6
101 2 811 910 C 100 100 101
Error! The length of read SOLEXA1_0001:1:74:18037:1025#0/1 (101) does not
match the length given in the SSAHA2 file (101)
SSAHA2 line: ALIGNMENT::14 32 SOLEXA1_0001:1:74:18037:1025#0/1 pFLC-I 33 2
739 770 C 32 100 101
Grep of corresponding lines in the SSAHA2 file:
Matches For Query 14754138 (101 bases): SOLEXA1_0001:1:74:16647:1029#0/1
ALIGNMENT::08 30 SOLEXA1_0001:1:74:16647:1029#0/1 pFLC-I 31
2 741 770 C 30 100.00 101
ALIGNMENT::08 27 SOLEXA1_0001:1:74:16647:1029#0/1 pFLC-I 29
2 735 762 C 28 100.00 101
Matches For Query 14758506 (101 bases): SOLEXA1_0001:1:74:17068:1020#0/1
ALIGNMENT::50 100 SOLEXA1_0001:1:74:17068:1020#0/1 pCMVSPORT6 101
2 811 910 C 100 100.00
101
Matches For Query 14768155 (101 bases): SOLEXA1_0001:1:74:18037:1025#0/1
ALIGNMENT::14 32 SOLEXA1_0001:1:74:18037:1025#0/1 pFLC-I 33
2 739 770 C 32 100.00 101
ALIGNMENT::14 27 SOLEXA1_0001:1:74:18037:1025#0/1 pFLC-I 29
2 735 762 C 28 100.00 101
Grep of corresponding lines in fastq file:
@SOLEXA1_0001:1:74:16647:1029#0/1
NCCCCTCGAAGGATCAGGCCCTTATGGCCTTTTTTTTTCTTTACAAATATAAAGCAGGTTTATTTGTGTATACCACTGGCATAACATAATGGGATCTAATA
+SOLEXA1_0001:1:74:16647:1029#0/1
BIIHFPLLQO``V``````````````````````VVVVVVVV`````````````````````VIPPRR```````V``BBBBBBBBBBBBBBBBBBBBB
@SOLEXA1_0001:1:74:17068:1020#0/1
NGGAAACAGCTATGACCATTAGGCCTATTTAGGTGACACTATAGAACAAGTTTGTACAAAAAAGCAGGCTGGTACCGGTCCGGAATTCCCGGGATATCGTC
+SOLEXA1_0001:1:74:17068:1020#0/1
BIFIIRRRRT```````````````````````````````````````````````````VVV```````````````````V`UYYYYUUUUS`````B
@SOLEXA1_0001:1:74:18037:1025#0/1
NCCCCTCGAAGGATCAGGCCCTTATGGCCTTAATTTTTTTTTTTTTGTTTTTTGTAGTTTTATTTACATACAATACAAACTACTTCTTTAACAAATGCATT
+SOLEXA1_0001:1:74:18037:1025#0/1
BJJGIPLLQQ`````````````````````````````BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
On Fri, Mar 26, 2010 at 3:19 PM, Bastien Chevreux <bach@xxxxxxxxxxxx> wrote:
> On Mittwoch 24 März 2010 Andy wrote:
> > There are no N's at the beginning of the sequences.
>
> Oh. Not good.
>
> Please file a bug report on Trac. Also, if you could put two or three of
> the
> reads which show this error into a file, that would be great. Lastly, pleae
> grep the SSAHA file for the names of these reads so that I can try to
> repoduce.
>
> Bastien
>
> --
> You have received this mail because you are subscribed to the mira_talk
> mailing list. For information on how to subscribe or unsubscribe, please
> visit http://www.chevreux.org/mira_mailinglists.html
>
Other related posts:
