Thank you very much Chistopher and Bastien. With your suggestions I was
able to figure out the mistake. After some reformatting I was able to
extract what I needed with no issues. I didn't need to download them again.
I does seem that after downloading SRA files from genbank MIRA doesn't like
them as-is.
Best regards and eternal gratitute!
Hernán
On Fri, Apr 10, 2015 at 11:35 AM, Christoph Hahn <chrisi.hahni@xxxxxxxxx>
wrote:
Hi Hernan,
I have prcessed SRA reads with MITObim before and never got any trouble
from MIRA. Anyway, some other software (dont remember what it was) didnt
like the SRA data. So I changed it before the data ever got to MIRA. I
guess Bastien would have pointed it out already if this was a known problem
of MIRA, but anyway what fixed it for me was to remove the " length=100"
from the header.
Also I have to say that I sometimes got incomplete/corrupted files from
SRA and the only fix was to download them again.
Other than that I think Bastiens suggestion will be your best call..
Good luck!
Christoph
On 06/04/2015 17:26, Hernan Vazquez Miranda wrote:
They look like this (head downyS10.fastq). I don't recall "I"s being so
pervasive in fastq file but I figured they'd be a little different coming
from a SRA file deposited in Genbank. Is there a solution or a way to
transform them?
Thanks! Hernán
@SRR949787.4.1 FCB065HABXX:6:1101:1197:1966 length=100
AGTCATTCACTTCGGGATCTTGTAAGGTGTCAAACTCATGGAGACCTGAAAGAATTCAAGCAAGGGAAAGGATGCACACCTGTAAAAGGGAAACGATGCACACCTGTAAAAATACTGCCCATCTACTTACCGTCCCACCCAAACCTTGATTATCTTTATGGTTACACAAGTGCTTTTCTTCAGGCAT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII?IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@SRR949787.14.1 FCB065HABXX:6:1101:1472:1976 length=100
GGGAGACTGCTGTGCTGGGAGACAGCTCAGCAGCTTGCAAAACTGAGAAATCAAGAAATAGGATGGGATAGGATGGGATAGGAGGGATAGGATGGGATAGGATGGGATAGGATAGGGTAGGATAGGATAGGATAGGATAGGATAGAATAGGATAGAATAGAATAGAATAGAATAGAATAGAAT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@SRR949787.18.1 FCB065HABXX:6:1101:1462:1999 length=100
AAACTGATCTACTACCAATACCAAATGAGGTAGAAATGCATAAGGGAACTAGGTCTTGGAATGTTACAGGTTTGAAATCAGTAATACCATTGACCATTGCCTGCAATTTGCCCAAATATAATTTGTTTCTCATGGTTGTCCAAATACAGAAGGCTTCAGGGTTCTTTCCAGTTCATACTCTGACTTG
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIGIIIIIFIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
On Mon, Apr 6, 2015 at 12:13 PM, Peter Cock <p.j.a.cock@xxxxxxxxxxxxxx>
wrote:
On Mon, Apr 6, 2015 at 5:08 PM, Hernan Vazquez Miranda <miran050@xxxxxxx>
wrote:
Hello everybody,them in
I've been fighting with the following problem trying to extract the
mitogenome of the recently deposited woodpecker genome in Genbank. I
downloaded one full lane, merge all pair-end reads, and concatenated
a single file. I had to subsample the full file to 10% because itwouldn't
run (Killed:9 error). Now it doesn't die but Mira won't work. ...
Loading data from FASTQ file:
/Users/Odontodactylus/Sanger_data/melanerpes/downyS10.fastq
(sorry, no progress indicator for that, possible only with zlib >=1.34)
Read SRR949787.4.1: invalid quality 170
Read SRR949787.20.1: invalid quality 171
Read SRR949787.20.1: invalid quality 167
... 4GB od these error lines
Read SRR949787.119142778.1: invalid quality 171
Read SRR949787.119142778.1: invalid quality 167
Read SRR949787.119142778.1: invalid quality 165
That looks to be the problem - bad FASTQ quality lines,
given the number of message, probably the entire file.
What does that file look like? e.g. read SRR949787.4.1
Peter
--
You have received this mail because you are subscribed to the mira_talk
mailing list. For information on how to subscribe or unsubscribe, please
visit http://www.chevreux.org/mira_mailinglists.html
--
*----
*
__ __
/ <` '> \
( / @ @ \ )
\(_ _\_/_ _)/
(\ `-/ \-' /)
"===\ /==="
.==')___(`==. hjw
' .=' `=.
*Hernán Vázquez Miranda, PhD*
*Postdoctoral Research Associate
Florida International University
Bracken-Grissom Lab*
http://www.brackengrissomlab.com
previous
,___,
(9v9)
(_^((\
jgs "^" \\
*University of Minnesota Dept. of Ecology, Evolution, and Behavior
hernan[at]*umn.edu and * Bell Museum of Natural History University of
Minnesota* http://www.bellmuseum.umn.edu/
