[mira_talk] Bug maf2sam conversion
- From: "Walter, Mathias" <mathias@xxxxxxxxx>
- To: mira_talk@xxxxxxxxxxxxx
- Date: Mon, 18 Nov 2013 14:25:36 +0100
Hi,
I've found a bug in miraconvert 4.0rc4 which produces an incorrect
CIGAR string. This prevents samtools view to convert the entire sam
file into a bam file.
Here is the error message I got from samtools:
Line 985061, sequence length 151 vs 152 from CIGAR
Parse error at line 985061: CIGAR and sequence length are inconsistent
If I look at line 985061 in the sam output I can see that the GIGAR
string sums up to 152 were the sequence length is 151.
SRR123456.925346 81 ref_bb 1 255 46S84M1D2M2D14M3D6M = 44206 0
AACAAGTAAATCGGATGTGTCAAACTCGCTATTTAAATATATATTATAACTAATTGTTGACATTTGTGCCTATTTATATATACTTAATGTGATACAGATTAAGCCATATATTTGTAAGCACTTATGAAAGACAGTCTCATTACCTTAAAAC
??FDFB.+C:DHFFFHHHFF@>HD=BEDFHHGFGDHGFHHHHHHHHGCACE87,EHFHFGFGFHHHHGFFCGFHHIHHHHFGGDGHHFHFHHHGHHGGHHHFHHHHGGHHHHHEHGGDBAGFFHHHHHHFCFFFFBBDDB?<DBBB?????
RG:Z:2 PT:Z:15
If I look at the proper read in the maf file I can see the following
read (reverse complement):
AT 1 113 45 157
RD SRR123456.925346/1
RG 2
RS
GTTTTA***AGGTAATGAGACTG**TC*TTTCATAAGTGCTTACAAATATATGGCTTAATCTGTATCACATTAAGTATATATAAATAGGCACAAATGTCAACAATTAGTTATAA*TATATATTTAAATAGCGAGTTTGACACATCCGATTTACTTGTT
RQ
?????BBBBBBD<?BDDBBFFFFDDCFGHHHHHHFFGABDGGHEHHHHHGGHHHHFHHHGGHHGHHHFHFHHGDGGFHHHHIHHFGCFFGHHHHFGFGFHFHE,78ECACGHHHHHHHHHFGHDGFGHHFDEB=DH>@FFHHHFFFHD:C+.BFDF??
TN SRR123456.925346
TS 1
QR 112
RT HAF3 1 1 = MIRA .
RT HAF5 2 18 = MIRA .
RT HAF4 19 19 = MIRA .
RT HAF5 20 36 = MIRA .
RT HAF4 37 38 = MIRA .
RT HAF3 39 42 = MIRA .
RT HAF5 43 61 = MIRA .
RT HAF3 62 64 = MIRA .
RT HAF5 65 74 = MIRA .
RT HAF3 75 78 = MIRA .
RT HAF5 79 88 = MIRA .
RT HAF4 89 95 = MIRA .
RT HAF7 96 105 = MIRA .
RT HAF5 106 112 = MIRA .
RT HAF3 113 116 = MIRA .
RT HAF4 117 117 = MIRA .
RT HAF5 118 138 = MIRA .
RT HAF3 139 142 = MIRA .
RT HAF5 143 152 = MIRA .
RT HAF4 153 158 = MIRA .
The last * is covered by the soft-clipped region and shout not be
counted. Hence the CIGAR string should start with "45S84..".
Fixing this manually resolves the conversion problem.
--
Kind regards,
Mathias
--
You have received this mail because you are subscribed to the mira_talk mailing
list. For information on how to subscribe or unsubscribe, please visit
http://www.chevreux.org/mira_mailinglists.html
Other related posts:
