[mira_talk] Re: Alignment errors in Solexa mapping
- From: Björn Nystedt <bjorn.nystedt@xxxxxxxxx>
- To: mira_talk@xxxxxxxxxxxxx
- Date: Thu, 10 Dec 2009 14:10:14 +0100
Sorry , the last example was a poor represenetative, the errors are more often
of this type:
> A similar error is quite common (mostly at the end of reads), at sites where
> there are (homopolymer) frameshifts in the reference genome:
gggcttgctgcaatawtttttttcggtttatatcgtctagtaattcaaaatggcca (consensus)
gggcttgctgcaataa*ttttttcggtttatatcgtctagtaattcaaaatggcca (reference/backbone)
ataatttttttcggtttatatcgtctagtaattcaaaa
at*ttttttcggtttatatcgtctagtaattcaaaatgg
t*ttttttcggtttatatcgtctagtaattcaaaatggc
> Again, MIRA overpredicts diversity, since all three reads are identical, and
> there should be no a/t ambiguity (w) in the consensus in this case.
B
On Thu, 10 Dec 2009 13:34:42 +0100
Björn Nystedt <bjorn.nystedt@xxxxxxxxx> wrote:
> Hi all,
> having fun learning to work with Solexa reads :)
>
> I was mapping Solexa reads to a reference genome (= a single contig from an
> earlier MIRA assembly) using MIRA V3rc4d (sorry Bastien, missed the strain
> info again..)
>
> mira --project=BAnh1IrMREF07 --job=mapping,genome,accurate,solexa
> -OUT:ora=yes -GE:not=3 -AS:
> urd=yes -SB:lb=yes:bft=fasta:bbq=30 SOLEXA_SETTINGS -LR:ft=fastq:fqqo=64
> -CO:msr=yes -GE:uti=
> no:tismin=200:tismax=400
>
> Going through the alignments, I noticed some odd parts, such as this:
>
> attggcgtgaagagtttgaatgagattgattgmmwgccagagaggccagaatatgttacaccgccgtcga
> (consensus)
> attggcgtgaagagtttgaatgagattgattgcmagccagagaggccagaatatgttacaccgccgtcga
> (reference/backbone)
> attggcgtgaagagtttgaatgagattgattgccag**agn
> attggcgtgaagagtttgaatgagattgattgccag**agn
> attggcgtgaagagtttgaatgagattgattgccag**agn
> ttggcgtgaagagtttgaatgagattgattgccag**agan
> tggcgtgaagagtttgaatgagattgattgccag**agagn
> ggcgtgaagagtttgaatgagattgattgccag**agag*gn
> ggcgtgaagagtttgaatgagattgattgccag**agag*gn
> ggcgtgaagagtttgaatgagattgattgccag**agag*gn
> gtgaagagtttgaatgagattgatt****gccagagaggccan
> gtgaagagtttgaatgagattgatt****gccagagaggccan
> gtgaagagtttgaatgagattgatt****gccagagaggccan
> gtgaagagtttgaatgagattgatt****gccagagaggccan
> tgaagagtttgaatgagattgatt****gccagagaggccagn
> tgaagagtttgaatgagattgatt****gccagagaggccagn
> gattgattgccagagaggccagaatatgttacaccgccn
> attgccagagaggccagaatatgttacaccgccgtcga
>
>
> (Note that these are only a few selected reads in the alignment; we have
> ~120X at this site which is normal given the amount of data). As you see,
> there are 3 predicted variants (all three are present in both strand
> directions):
>
> 1) ttgccag**agag*g (30 reads)
> 2) tt****gccagagag (70 reads)
> 3) ttgattgccagagag (20 reads)
>
> This is an overprediction of the diversity, since the two top reads are
> really identical.
>
> Anyone seen this behaviour before?
> Could it be caused by the wildcard charachers in the reference (although
> similar things sometimes happens also when there are no wildcards)?
> Any ideas on strategies/parameters to avoid it?
>
>
> A similar error is quite common (mostly at the end of reads), at sites where
> there are (homopolymer) frameshifts in the reference genome:
>
> aaagacgataaaaaatatcgcaatgaaaaataaaaaagawtttttttgttttatc(consensus)
> aaagacgataaaaaatatcgcaatgaaaaat*aaaaagaatttttttgttttatcac (reference/backbone)
> nataaaaaatatcgcaatgaaaaataaaaaag*atttttt
> naaaaaatatcgcaatgaaaaataaaaaagatttttttt
>
> Again, MIRA overpredicts diversity, since these two reads are identical, and
> there should be no a/t ambiguity (w) in the consensus in this case.
>
> Any help or comments are welcome!
> B
>
> PS. In our case the problems below can likely be avoided by doing a de-novo
> or de-novo-like assembly with all our current data, but we are working on a
> range of strategies at the moment to learn about different possibilities, and
> I thought the aboce behaviours were of general interest and worth discussing
> on the list.
>
> PS2. I am a bit confused regarding the initial n:s of the reads, not sure yet
> why they appear...
>
>
>
>
>
>
>
>
>
>
>
>
> ====================================
> Björn Nystedt, PhD
> Molecular Evolution
> EBC, Uppsala University
> Norbyv. 18C, 752 36 Uppsala
> Sweden
> phone: +46 (0)18-471 45 88
> email: Bjorn.Nystedt@xxxxxxxxx
> ====================================
>
> --
> You have received this mail because you are subscribed to the mira_talk
> mailing list. For information on how to subscribe or unsubscribe, please
> visit http://www.chevreux.org/mira_mailinglists.html
--
====================================
Björn Nystedt, PhD
Molecular Evolution
EBC, Uppsala University
Norbyv. 18C, 752 36 Uppsala
Sweden
phone: +46 (0)18-471 45 88
email: Bjorn.Nystedt@xxxxxxxxx
====================================
--
You have received this mail because you are subscribed to the mira_talk mailing
list. For information on how to subscribe or unsubscribe, please visit
http://www.chevreux.org/mira_mailinglists.html
Other related posts:
