[mira_talk] Re: 454 cleaning
- From: Robin Kramer <kodream@xxxxxxxxx>
- To: mira_talk@xxxxxxxxxxxxx
- Date: Thu, 2 Dec 2010 10:28:08 -0700
So the cross_match + smalt seems to have done the trick.
When I BLAST the adapters against the created contigs no hits are found.
In the repeat histogram, the maximum repeat is 324 as opposed 40,000.
And on top of it. The N50 is 1150 as compared to the 850 before and the
largest contig is 8000, as opposed to 4000.
WASH RINSE and REPEAT!
Sincerely yours,
Robin
On Tue, Nov 30, 2010 at 2:17 PM, Bastien Chevreux <bach@xxxxxxxxxxxx> wrote:
> On Dienstag 30 November 2010 Robin Kramer wrote:
> > It is hard to tell if SMALT is doing any better with those settings.
>
> MIRA will probably not be of much help in deciding which filtering was
> better.
> What you could do is: run the filtered library again through some search
> program (BLAST or FASTA3) and count hits (above a certain threshold).
>
> > I am wondering if MIRA is reconstructing noisy adapters, that the
> aligners
> > aren't able to find, almost doing too good of a job being able to
> assemble
> > even the faintest of adapter sequence signal.
>
> *rotfl* That made my day.
>
> > In any case the vector is still making chimera looking things by the
> > cat
> >
> SRR054580_Asha_assembly/SRR054580_Asha_d_results/SRR054580_Asha_out.unpadde
> > d.fasta
> >
> > | seqs_filter_by_len -s 100 | grep AAGCAGTGGTATCAACGCAGAGTACGGGGG|wc -l
> >
> > 3498
> > The adapter is highlighted in this chimera.
> > CAACTCCAACGCATGAATGCCCTCAAGCAGTGGTATCAACGCAGAGTACGGG
> > GGGTGGGTTCATGAGACATGGAACCCTA
>
> Hmmm ... have you tried to track down how this sequence came to be? Just by
> looking at this very contig in an assembly viewer ... gap4 or tablet? If
> need
> to be, use "convert_project -f maf -t txt" (or even "-t html"). Is it two
> reads with partial adaptors assembled or just one read with an adaptor not
> found? In any case, you should then look up the SSAHA2 / SMALT hit files
> for
> that read (those reads) to see what happened. Maybe they were found but the
> SSAHA2 / SMALT filtering routines from MIRA were too strict in the
> parameters
> and did not filter? that would be interesting (and important) to know, so
> that
> I could take some countermeasures.
>
> B.
>
> --
> You have received this mail because you are subscribed to the mira_talk
> mailing list. For information on how to subscribe or unsubscribe, please
> visit http://www.chevreux.org/mira_mailinglists.html
>
Other related posts:
