When does the error occur, immediately? What does the error say? 2010/12/10 Artemus Harper <subanark@xxxxxxxxx> > I'm trying to use sff_extract, but I ran into an error: > $ sff_extract_0_2_8 -o cherry_454 -l linker.fasta -i > "insert_size:8000,insert_stdev:750" 454_paired_end_8kb_reads/GQKO24N02.sff > Working on '454_paired_end_8kb_reads/GQKO24N02.sff': > Creating temporary sequences from reads in > '454_paired_end_8kb_reads/GQKO24N02.sff' ... done. > Searching linker sequences with SSAHA2 (this may take a while) ... > > An error occured during the SSAHA2 execution, aborting. > > My linker file is: > >cherry_linker_1 > TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG > >cherry_linker_2 > AGCATATTGAAGCATATTACATACGATATGCTTCAATAATGC > > -- > Artemus Harper >