[mira_talk] Re: (No From: Bastien Chevreux <bach@xxxxxxxxxxxx>
- From: Torben Nielsen <torben@xxxxxxxxxx>
- To: mira_talk@xxxxxxxxxxxxx
- Date: Sun, 14 Dec 2014 21:42:53 -1000
I looked at the input reads to MIRA. They are fastq files and the first two and
the last two entries are legit. That is, matching sequence number plus
forward/reverse label. Standard Illumina stuff. So those are good. Then I
looked at the readpool.maf file (tail) and that looked to be matching at the
end too.
But then did a line on the output from miraconvert and I got 3403276. And I
don’t think that can be since it’s not divisible by 8. I played with
deinterleaving the file as well and it’s clear that there are 4 lines missing.
Worse, they are not at the end or the beginning where it’s obvious.
Attached is a snippet from a deinterleaved file that shows some context. It
appears that it got out of sync right where it went from empty reads
(completely clipped I assume) to reads with something left. Somehow 4 lines are
being missed/added. Not sure which. This is a smallish file (300 MB) and I can
upload it if that helps.
I’m waiting for someone to tell me that I’m missing something obvious. It’s
been a long Sunday so it’s not unlikely :-(
Thanks, Torben
@M02545:8:000000000-A92DB:1:1102:16316:1692/2
N
+
!
@M02545:8:000000000-A92DB:1:1102:11073:1698/2
N
+
!
@M02545:8:000000000-A92DB:1:1102:18634:1698/2
N
+
!
@M02545:8:000000000-A92DB:1:1102:16835:1706/1
GGCTCGGCCATAAGGAGCGAGCTTCGGAT
+
@:FCGGGFGCGGD<EFEFCC7@@FE+8,8
@M02545:8:000000000-A92DB:1:1102:8628:1728/1
TTAGCGGCCATTCCCCTTTTTTTTTTTTT
+
GGGFC++@@+CC<,;@CC,6,+8@@+++8
@M02545:8:000000000-A92DB:1:1102:20479:1729/1
> On Dec 14, 2014, at 19:16, mira_talk-bounce@xxxxxxxxxxxxx wrote:
>
> On 15 Dec 2014, at 5:08 , Torben Nielsen <torben@xxxxxxxxxx> wrote:
>> Mira 4.9.3
>> Has anyone else seen cases where
>> miraconvert -C readpool.maf reads.fastq
>> appears to drop one or more reads? I have seen few cases now where one of a
>> pair appears to have gone missing?
>
> Are both reads of the pair present in the MAF in the first place?
>
> B.
>
>
> --
> You have received this mail because you are subscribed to the mira_talk
> mailing list. For information on how to subscribe or unsubscribe, please
> visit http://www.chevreux.org/mira_mailinglists.html
--
You have received this mail because you are subscribed to the mira_talk mailing
list. For information on how to subscribe or unsubscribe, please visit
http://www.chevreux.org/mira_mailinglists.html
Other related posts:
