[mira_talk] Re: viewing sff flowgrams in gap4

Hi all again.
I am really sorry, for the spam and for my previous message.

I found the problem!!!!

the mira is OK (and always beautiful), last version fixed the opening of
trev for flowgrams. It was my fault to do not put the correct path in
the trace file location field of GAP4.
Please everybody,

forget my last message.

Giuseppe 



On Wed, 2008-11-26 at 17:59 +0100, Giuseppe D'Auria wrote:
> Hi, 
> I tried adding the correct info in the caf file. I just manually added
> to some read of caf file
> SCF_File "sff_filename.sff" 
> after caf2gap it works perfectly in gap4 opening the trev with the
> flowgrams.
> 
> I tried on a new assembly made by the last version of mira you linked in
> the previous mail but the name it add as SCF_Filename is the read name
> and not the sff_filename.sff. The difference is really small. 
> Just an example: 
> 
> ---------------------------------------------------
> DNA : FA219MN01AOSOV
> tcagGGCAGCGAGGCCCGAACCCTATTTCTCCTTTCCGTCATGCTTTTATCCTACGCCGT
> TCCTACCATACTTGGCGGCAATGGCTATCTGGGGACCTATCTTTGCGGGATTCATCTAGG
> AAACGCGCCCATGCC-ACAAAAGCGGAATCTGGTGCAcctgagacacgcaacgaggggat
> aggcaaggcacacaggggataggnn
> 
> BaseQuality : FA219MN01AOSOV
> 32 33 31 30 30 27 24 24 25 31 24 19 18 18 27 27 29 30 30 30 27 26 26 30
> 28 23 22 22 28 17 22
> 22 17 17 17 22 22 33 23 28 27 27 24 25 25 29 29 29 30 20 31 31 30 32 32
> 32 32 32 32 32 32 32
> 32 32 32 30 30 30 30 32 28 23 23 24 24 32 30 30 30 31 29 29 29 30 30 30
> 31 27 23 23 23 23 27
> 27 29 29 30 30 30 28 27 18 18 18 23 27 30 23 23 23 23 26 28 28 30 30 30
> 28 21 21 17 17 17 21
> 24 28 28 25 25 25 28 26 21 21 21 1 21 20 21 22 21 21 21 25 25 28 28 28
> 28 28 28 21 21 21 20
> 22 26 26 26 26 29 29 28 28 29 28 30 30 30 30 17 17 17 21 17 17 17 17 26
> 29 28 27 27 25 25 25
> 27 27 27 21 21 15 15 15 15 15 15 15 15 24 23 23 26 0 0 
> 
> Sequence : FA219MN01AOSOV
> Is_read
> Padded
> SCF_File "FA219MN01AOSOV"
> Seq_vec SVEC 1 5
> Seq_vec SVEC 158 205
> Clipping QUAL 1 165
> Align_to_SCF 1 135 1 135
> Align_to_SCF 137 205 136 204
> Tag MINF 1 1 "ST=454GS"
> -------------------------------------------------------------------
> the line:
> SCF_File "FA219MN01AOSOV" 
> 
> should be 
> 
> SCF_File "FA219MN01.sff"
> 
> 
> I think that for this reason gap4 is not able to open the sff flowgrams
> also because it says
> 
> 'FA219MN01AOSOV': couldn't open
> 
> pointing to the read name.
> 
> Please, can you consider this problem? it will be helpful specially when
> correcting homopolymers errors.
> 
> Thank you in advance and have a nice day
> 
> Giuseppe D'Auria
> 
> 
> 
> .......
> 
> On Sun, 2008-11-23 at 18:02 +0100, Bastien Chevreux wrote: 
> > On Friday 21 November 2008 16:56, Giuseppe D'Auria wrote:
> > > Hi All,
> > > I do not know if it the correct place to past this question.
> > > I installd Staden V4.11 On my Linux 64bit AMD machine.
> > >
> > > After the assembly of my sff files by standard procedure with manual
> > > parameters I obtained without problems caf and ace files, then I
> > > converted them in aux to open with my working gap4.
> > >
> > > Now I am not able to open the flowgrams. I setted the trace file
> > > location pointing to the sff file (SFF=filename.sff) in the trace file
> > > location field of gap4. I am able to open standard ABI file (ztr) added
> > > to the assembly but I am not able to view my original sff traces.
> > > No error message appears in my shell.
> > >
> > > Someone have some idea?
> > 
> > I never used the flowgrams myself during cleanup, so this feature was not 
> > followed through in the development. Nevertheless, I've now added the 
> > necessary info to the CAF files when they're written.
> > 
> > http://www.chevreux.org/tmp/mira_2.9.35x1_dev_linux-gnu_x86_64.tar.bz2
> > 
> > You will need to reassemble your projects though (I'm sorry for the 
> > inconvenience) or write a script that adds the name of the read as 
> > "SCF_File" 
> > entry to CAF files for every read that does not have one already.
> > 
> > Regards,
> >   Bastien
> > 
> -- 
> Dr. Giuseppe D'Auria
> 
> Cavanilles Institute for
> Biodiversity and Evolutionary Biology
> University of Valencia
> "Poligono de la Coma" s/n
> 46980 Paterna (Valencia),Spain
> 
> web: http://www.uv.es/cavanilles/genevol/
> tel: +34 9635 43646
> 
> 
> 
-- 
Dr. Giuseppe D'Auria

Cavanilles Institute for
Biodiversity and Evolutionary Biology
University of Valencia
"Poligono de la Coma" s/n
46980 Paterna (Valencia),Spain

web: http://www.uv.es/cavanilles/genevol/
tel: +34 9635 43646



-- 
You have received this mail because you are subscribed to the mira_talk mailing 
list. For information on how to subscribe or unsubscribe, please visit 
http://www.chevreux.org/mira_mailinglists.html

Other related posts: