[mira_talk] Re: viewing sff flowgrams in gap4
- From: "Giuseppe D'Auria" <giuseppe.dauria@xxxxx>
- To: mira_talk@xxxxxxxxxxxxx
- Date: Wed, 26 Nov 2008 17:59:06 +0100
Hi,
I tried adding the correct info in the caf file. I just manually added
to some read of caf file
SCF_File "sff_filename.sff"
after caf2gap it works perfectly in gap4 opening the trev with the
flowgrams.
I tried on a new assembly made by the last version of mira you linked in
the previous mail but the name it add as SCF_Filename is the read name
and not the sff_filename.sff. The difference is really small.
Just an example:
---------------------------------------------------
DNA : FA219MN01AOSOV
tcagGGCAGCGAGGCCCGAACCCTATTTCTCCTTTCCGTCATGCTTTTATCCTACGCCGT
TCCTACCATACTTGGCGGCAATGGCTATCTGGGGACCTATCTTTGCGGGATTCATCTAGG
AAACGCGCCCATGCC-ACAAAAGCGGAATCTGGTGCAcctgagacacgcaacgaggggat
aggcaaggcacacaggggataggnn
BaseQuality : FA219MN01AOSOV
32 33 31 30 30 27 24 24 25 31 24 19 18 18 27 27 29 30 30 30 27 26 26 30
28 23 22 22 28 17 22
22 17 17 17 22 22 33 23 28 27 27 24 25 25 29 29 29 30 20 31 31 30 32 32
32 32 32 32 32 32 32
32 32 32 30 30 30 30 32 28 23 23 24 24 32 30 30 30 31 29 29 29 30 30 30
31 27 23 23 23 23 27
27 29 29 30 30 30 28 27 18 18 18 23 27 30 23 23 23 23 26 28 28 30 30 30
28 21 21 17 17 17 21
24 28 28 25 25 25 28 26 21 21 21 1 21 20 21 22 21 21 21 25 25 28 28 28
28 28 28 21 21 21 20
22 26 26 26 26 29 29 28 28 29 28 30 30 30 30 17 17 17 21 17 17 17 17 26
29 28 27 27 25 25 25
27 27 27 21 21 15 15 15 15 15 15 15 15 24 23 23 26 0 0
Sequence : FA219MN01AOSOV
Is_read
Padded
SCF_File "FA219MN01AOSOV"
Seq_vec SVEC 1 5
Seq_vec SVEC 158 205
Clipping QUAL 1 165
Align_to_SCF 1 135 1 135
Align_to_SCF 137 205 136 204
Tag MINF 1 1 "ST=454GS"
-------------------------------------------------------------------
the line:
SCF_File "FA219MN01AOSOV"
should be
SCF_File "FA219MN01.sff"
I think that for this reason gap4 is not able to open the sff flowgrams
also because it says
'FA219MN01AOSOV': couldn't open
pointing to the read name.
Please, can you consider this problem? it will be helpful specially when
correcting homopolymers errors.
Thank you in advance and have a nice day
Giuseppe D'Auria
.......
On Sun, 2008-11-23 at 18:02 +0100, Bastien Chevreux wrote:
> On Friday 21 November 2008 16:56, Giuseppe D'Auria wrote:
> > Hi All,
> > I do not know if it the correct place to past this question.
> > I installd Staden V4.11 On my Linux 64bit AMD machine.
> >
> > After the assembly of my sff files by standard procedure with manual
> > parameters I obtained without problems caf and ace files, then I
> > converted them in aux to open with my working gap4.
> >
> > Now I am not able to open the flowgrams. I setted the trace file
> > location pointing to the sff file (SFF=filename.sff) in the trace file
> > location field of gap4. I am able to open standard ABI file (ztr) added
> > to the assembly but I am not able to view my original sff traces.
> > No error message appears in my shell.
> >
> > Someone have some idea?
>
> I never used the flowgrams myself during cleanup, so this feature was not
> followed through in the development. Nevertheless, I've now added the
> necessary info to the CAF files when they're written.
>
> http://www.chevreux.org/tmp/mira_2.9.35x1_dev_linux-gnu_x86_64.tar.bz2
>
> You will need to reassemble your projects though (I'm sorry for the
> inconvenience) or write a script that adds the name of the read as "SCF_File"
> entry to CAF files for every read that does not have one already.
>
> Regards,
> Bastien
>
--
Dr. Giuseppe D'Auria
Cavanilles Institute for
Biodiversity and Evolutionary Biology
University of Valencia
"Poligono de la Coma" s/n
46980 Paterna (Valencia),Spain
web: http://www.uv.es/cavanilles/genevol/
tel: +34 9635 43646
--
You have received this mail because you are subscribed to the mira_talk mailing
list. For information on how to subscribe or unsubscribe, please visit
http://www.chevreux.org/mira_mailinglists.html
Other related posts: