[mira_talk] dependencies between X masked data and traceinfo.xml data in mira clipping behaviour

Hi all,

Does anyone have experience in using together traceinfo.xml data and X 
masked sequences with mira ?

I mean, looking at the doc of mira :

maskedbases_clip(mbc)=on|yes|1, off|no|0 
Default is dependent of the sequencing technology used. This will let mira 
perform a 'clipping' of bases that were masked out (replaced with the 
character X). It is generally not a good idea to use mask bases to remove 
unwanted portions of a sequence, the EXP file format and the NCBI 
traceinfo format have excellent possibilities to circumvent this. But 
because a lot of preprocessing software are built around cross_match, 
scylla- and phrap-style of base masking, the need arised for mira to be 
able to handle this, too. mira will look at the start and end of each 
sequence to see whether there are masked bases that should be 'clipped'. 

It looks like Xs are clipped at some point, but it doesn't say when, and i 
wonder if there could be a problem in the clipping process from the
data contained into the xml file in case this clipping is done after the 
other.. (assuming that clipping means actually removing of a region)

Indeed, if i have a sequence like this one:

>FAINC1H01EKDXQ 
TCAGACGAGTGCGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAGCAGA
GATGATGTGGGCAAGTTCCTTCCCACATACTTGGCGCAGGGAATCCTTCA
GAGCGCTGAGCGGGCTGGCAAGGC

and traceinfo data like this:

        <trace>
                <trace_name>FAINC1H01EKDXQ</trace_name>
                <trace_type_code>454</trace_type_code>
                <program_id>454Basecaller</program_id>
                <clip_quality_left>15</clip_quality_left>
                <clip_quality_right>105</clip_quality_right>
        </trace>

if mira clips first the Xs, and then try to clip the sequence using the 
traceinfo data,
will the sequence not be too short to be clipped at base 105 ?

I appologyze if this is a stupid question, as i'm not familiar with 
general clipping behaviour of bioinformatics tools.

But if someone could tell me that mira will have no trouble handling this, 
that would be great !

Regards,

Jorge.


--- 
Jorge Duarte
Bioinformatics Research Engineer
BIOGEMMA - Upstream Genomics Group
Z.I. Du Brézet
8, Rue des Frères Lumière
63028 CLERMONT FERRAND Cedex 2
FRANCE
Tel : +33 (0)4 73 39 60 73
Fax : +33 (0)4 73 39 60 71
E-mail : jorge.duarte@xxxxxxxxxxxx

*****************************************************************
       Pour toute demande de support merci d'inclure
BIOGEMMA_BioInfo_Service ou bioinfo@xxxxxxxxxxxx
         dans les destinataires lors du premier contact
*****************************************************************
BIOGEMMA S.A.S. au capital social de 48.335.652,00 ?. 1, Rue Edouard 
Colonne - 75001 PARIS. RCS PARIS 412 514 366
This message and any attachments are confidential and intended solely for 
the use of the addressee(s) named above. The information contained in this 
email may also be legally privileged. If you have received this email in 
error, please notify us immediately by reply email or by fax and then 
delete it. Any use, distribution or reproduction of this message is 
strictly prohibited. The integrity or authenticity of this message cannot 
be guaranteed. We therefore shall not be liable for the message if 
altered, changed or falsified. Thank you.

Cet email et ses pièces jointes sont strictement confidentiels et destinés 
uniquement à l'usage du (des) destinataire(s) sus-indiqué(s). Les 
informations contenues dans cet email sont légalement protégées. Si vous 
avez reçu cet email par erreur, merci de nous le retourner immédiatement 
par courrier électronique ou télécopie avant de le supprimer. Toute 
utilisation ou reproduction de cet email est strictement interdite. La 
véracité et l'authenticité de cet email et de son contenu ne peuvent être 
garanties et nous ne pouvons être tenus responsables de leur altération, 
modification ou falsification. Merci.

Other related posts: