[mira_talk] Re: Question: padded or unpadded outputs
- From: Peter Cock <p.j.a.cock@xxxxxxxxxxxxxx>
- To: lenis vasilis <val1@xxxxxxxxxx>
- Date: Mon, 23 Mar 2015 22:18:31 +0000
On Mon, Mar 23, 2015 at 7:02 PM, lenis vasilis <val1@xxxxxxxxxx> wrote:
> Hi Peter,
>
> Thank you very much for the script but I have some problems when I'm running
> it.
> When I run it with the sample that I sent you it runs smoothly, both for
> padded and unpadded.
>
> When I run it with the other sample (the sample that I had problem with
> Mira_convert in Mira's previous version, and I solved it with your
> exhortation to run it in a newer version).
>
> Here is the std output:
>
> [maf2sam] NOTE: Producing SAM using a gapped reference sequence.
> [maf2sam] Identified as MIRA v3.9 or later (MAF v2)
> [maf2sam] WARNING - Support for this is *still* EXPERIMENTAL!
> [maf2sam] Identified 3 read groups
> [maf2sam] Starting main pass though the MAF file
> [maf2sam] Unpaired read chrM
> [maf2sam] Almost done, 436 orphaned paired reads remain
> Traceback (most recent call last):
> File "./maf2sam.py", line 781, in <module>
> print current_read
> File "./maf2sam.py", line 239, in __str__
> raise ValueError("%s vs %i for %s" % (cigar, len(read_seq_unpadded),
> read_seq))
> ValueError: 17S59M26S vs 101 for
> TTCCT*CATGACACATAGTTAATGTAGCTTAAAATTAAAGCAAGGCACTGAAAATGCCTAGATGAGTATATTAACTACATAAACATATAGGTTTTGGTCCCA
>
> Thank you very much,
> Vasilis.
I think my script is getting confused by the * (gap)
within the soft-clipped part of the read. I am guessing
that MIRA did some trimming after some alignment
process had inserted the gap. Perhaps I simply
didn't have a broad enough set of test data before?
Could you send me this MAF file by dropbox too?
Thanks,
Peter
--
You have received this mail because you are subscribed to the mira_talk mailing
list. For information on how to subscribe or unsubscribe, please visit
http://www.chevreux.org/mira_mailinglists.html
Other related posts:
