[mira_talk] Re: Mappging to Reference

Contig is the unpadded contig
read is the padded contig
fasta is the reference fasta.
I have solved this problem already.
As I have stated, i wanted to be able to align both sequences and "events"
so that i could align it with the data about the sequence.
In this example, i have the reference sequence aligned with the gapped
contig and all SNPs, gaps, insertions, deletions, regions of low quality
(called events - S stands for SMTP) and ND (regions without reads) plus
mapped genes and microarrays probes.
Now i can try to correlate modifications of the dna with microarray profiles
and disruptions of important genes. Well, might be a long shot.
Regards,



                                                                SNP
                                                                 ||
INSERTION                   SNP     INSERTION
                                                                 || |
                    |       |
REFERENCE: 1
A--------------------------------------------------TTC-ACATCTCTTTGTTGCGCGATGTGATTGGCTTCTTC-CCCCTAAGG
100
  CONTIG  : 1
AGCACATCGACAATTTTTGGGGGTCATACACTGATCTCCTGGCTTTAGATCGCCAACATCTCTTTGTTGCGCGATGTGATTGTCTTCTTCACCGCGAAGG
100
     SNP  : 1
s--------------------------------------------------ss-----------------------------s----------s-s----
100 SNPS
     INS  : 1
-iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii---i-----------------------------------i---------
100 INSERTIONS
     GAP  : 1
----------------------------------------------------------------------------------------------------
100 GAPS
     DEL  : 1
----------------------------------------------------------------------------------------------------
100 DELETIONS
   EVENT  : 1
M--------------------------------------------------SSS-SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS-SSSSSSSSS
100 LOW QUALITY
      ND  : 1
----------------------------------------------------------------------------------------------------
100 LOW COV./NO DATA
    GENE  : 1
-------------------------------------------------------CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC-CCCCCCCCC
100 GENE
   MICRO  : 1
----------------------------------------------------------------------------------------------------
100 MICROARRAY

                            SNP               DELETION
                             | |               |
REFERENCE : 101
CGCCGCCAGGGGGCCGGCCGGGCACACTGGCGTTTTTTTCACAACCTCCTGGCTGGTCAGCATCTCTGCGATCCTTGTGATAAAAGAGGCTACGTATCGT
200
   CONTIG  : 101
CGCCGCCAGGGGTCTGGCCGGTCACACTGG*GTGAGTTTCACAACCTCCTGTCTGGTCAGCATCTCTGCGATCCTTGTGATAAAAGAGGCTACGTATCGT
200
      SNP  : 101
------------s-s------s-----------sss---------------s------------------------------------------------
200
      INS  : 101
----------------------------------------------------------------------------------------------------
200
      GAP  : 101
----------------------------------------------------------------------------------------------------
200
      DEL  : 101
------------------------------d---------------------------------------------------------------------
200
    EVENT  : 101
SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
200 LOW QUALITY
       ND  : 101
----------------------------------------------------------------------------------------------------
200
     GENE  : 101
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
200 GENE
    MICRO  : 101
----------------------------------------------------------------------------------------------------
200


                  GAP

                  |
REFERENCE: 5801
GGAGGTCATTCTTGAGCGGGGGGAACTGGATGTCCCTCCATGAGTTGACAAGGTCGAGTTTGGGGACTGCGTGGGACA-TTGTGTGT-TATG-GTATGTA
5900
   CONTIG : 5801
GGAGGTCATTCTTGAGCGGGGGGAACTGGATGTCCCTCCATGAGTTGACAAGGTCGAGTTTGGGGACTGCGTGGGACA*TTGTGTGT*TATG*GTATGTA
5900
      SNP : 5801
----------------------------------------------------------------------------------------------------
5900
      INS : 5801
----------------------------------------------------------------------------------------------------
5900
      GAP : 5801
------------------------------------------------------------------------------g--------g----g-------
5900
      DEL : 5801
----------------------------------------------------------------------------------------------------
5900
    EVENT : 5801
----------------------------------------------------------------------------------------------------
5900
       ND : 5801
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx-xxxxxxxx-------------
5900 LOW QUAl
     GENE : 5801
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC-CCCCCCCC-CCCC-CCCCCCC
5900 GENE
    MICRO : 5801
----------------------------------------------------------------------------------------------------
5900

----------------
s.

Other related posts: