Hello Bastien, I could successifully perform the alignment. thank you very much. I still have a question. How do i interpret this data: This position would be a insertion This position would be a deletion | | CONTIG : 1 TAACGCCAAAAAAATCAAAAAATCTAAAAAAACTCATTTTTCCGCGCCATTTTTCATTTTTGTTGCGATTTCACTTGCAAAAATGTGCAGG*TAACCGCG 100 READ : 1 ------------------------------------------------ATTTTTC*TTTTTGTTGCGATTTCACTTGCAAAAATGTGCAGGCTAACCGCG 100 FASTA : 1 ------------------------------------------------ATTTTTC-TTTTTGTTGCGATTTCACTTGCAAAAATGTGCAGGCTAACCGCG 100 what would this position be? | CONTIG : 101 TTTTTTGTGAACTTAGGGCGAAATAAATGAGTCAATCAGTACGCAACAT**GCTTC*TGAATCAGGTATAGCATGATACATTTCATACATAAATCATTAT 200 READ : 101 TTTTTTGTGAACTTAGGGCGAAATAAATGAGTCAATCAGTACGCAACAT**GCTTC*TGAATCAGGTATAGCATGATACATTTCATACATAAATCATTAT 200 FASTA : 101 TTTTTTGTGAACTTAGGGCGAAATAAATGAGTCAATCAGTACGCAACAT--GCTTC-TGAATCAGGTATAGCATGATACATTTCATACATAAATCATTAT 200 Regards ---------------- s. On Sat, Jun 12, 2010 at 10:01 PM, Bastien Chevreux <bach@xxxxxxxxxxxx> wrote: > On Freitag 11 Juni 2010 Saulo Alves wrote: >> Sorry if i didn't make myself clear. >> events stands for all the tags mira add's to the sequencing. Gaps, >> SNPs, repeats. >> >> I have tried the AO process but, after placing the gaps, there are >> still discrepancies. >> for one chromossome my FASTA reference has 1.462.416 bp. the "PADDED" >> (w/ gaps) generated sequence has 1.462.514 bp and the "UNPADDED" >> sequence has 1.462.431 bp. >> There's this difference (+17) between the original and unpadded which >> i cant explain neither map back. If i want to know where in the >> reference sequence a SNP was found, i'm not able with a 17bp >> discrepancy and, for other chromossome, this difference get's even >> bigger. > > Hmm ... have a look at the TCS file, column 2 & 3 with the padded pos and > unpadded pos. Would that help? > > B. > > -- > You have received this mail because you are subscribed to the mira_talk mailing list. For information on how to subscribe or unsubscribe, please visit http://www.chevreux.org/mira_mailinglists.html >