[mira_talk] Re: Mappging to Reference

Hello Bastien,

I could successifully perform the alignment. thank you very much.
I still have a question.
How do i interpret this data:

This position would be a insertion                       This position would
be a deletion

|                                                                       |
 CONTIG :       1
TAACGCCAAAAAAATCAAAAAATCTAAAAAAACTCATTTTTCCGCGCCATTTTTCATTTTTGTTGCGATTTCACTTGCAAAAATGTGCAGG*TAACCGCG
    100
   READ :       1
------------------------------------------------ATTTTTC*TTTTTGTTGCGATTTCACTTGCAAAAATGTGCAGGCTAACCGCG
    100
  FASTA :       1
------------------------------------------------ATTTTTC-TTTTTGTTGCGATTTCACTTGCAAAAATGTGCAGGCTAACCGCG
    100


                                                         what would this
position be?

|
 CONTIG :     101
TTTTTTGTGAACTTAGGGCGAAATAAATGAGTCAATCAGTACGCAACAT**GCTTC*TGAATCAGGTATAGCATGATACATTTCATACATAAATCATTAT
    200
   READ :     101
TTTTTTGTGAACTTAGGGCGAAATAAATGAGTCAATCAGTACGCAACAT**GCTTC*TGAATCAGGTATAGCATGATACATTTCATACATAAATCATTAT
    200
  FASTA :     101
TTTTTTGTGAACTTAGGGCGAAATAAATGAGTCAATCAGTACGCAACAT--GCTTC-TGAATCAGGTATAGCATGATACATTTCATACATAAATCATTAT
    200

Regards

----------------
s.



On Sat, Jun 12, 2010 at 10:01 PM, Bastien Chevreux <bach@xxxxxxxxxxxx>
wrote:
> On Freitag 11 Juni 2010 Saulo Alves wrote:
>> Sorry if i didn't make myself clear.
>> events stands for all the tags mira add's to the sequencing. Gaps,
>> SNPs, repeats.
>>
>> I have tried the AO process but, after placing the gaps, there are
>> still discrepancies.
>> for one chromossome my FASTA reference has 1.462.416 bp. the "PADDED"
>> (w/ gaps) generated sequence has 1.462.514 bp and the "UNPADDED"
>> sequence has 1.462.431 bp.
>> There's this difference (+17) between the original and unpadded which
>> i cant explain neither map back. If i want to know where in the
>> reference sequence a SNP was found, i'm not able with a 17bp
>> discrepancy and, for other chromossome, this difference get's even
>> bigger.
>
> Hmm ... have a look at the TCS file, column 2 & 3 with the padded pos and
> unpadded pos. Would that help?
>
> B.
>
> --
> You have received this mail because you are subscribed to the mira_talk
mailing list. For information on how to subscribe or unsubscribe, please
visit http://www.chevreux.org/mira_mailinglists.html
>

Other related posts: