Hi everyone,
I am having trouble with a MIRA error message and would be grateful for any
advice.
I am assembling simulated illumina paired end reads. The assembly starts to
run, however stops with the message:
Fatal error (may be due to problems of the input data or parameters):
********************************************************************************
* MIRA found readgroups where pairs are expected but no read has a partner. *
* See log above and then check your input please (either manifest file or data *
* files loaded or segment_naming scheme). *
********************************************************************************
->Thrown: void Assembly::basicReadGroupChecks()
->Caught: main
Aborting process, probably due to error in the input data or parametrisation.
My config file is as follows:
project = Assembly_A
job = genome,denovo,accurate
readgroup = ProfileA_paired
data = ProfileA_paired.fa
technology = solexa
template_size = 2000 4000 autorefine
segment_placement = ---> <---
segment_naming = solexa
parameters= --noqualities
My paired end reads are all compiled into one file, where 1.1 and 1.2 are a set
of paired reads
r1.1GTCGCTGCAGGGGCGCGACTCGGCGCGCGTGCGCGACTCGGCGCGCGTGCGCGACTTCGCGCTCT
|SOURCES={KEY=bf97e692...,bw,559392-559472}|ERRORS={}|SOURCE_1="CP007128.1
Gemmatimonadetes bacterium KBS708, complete genome"
(bf97e6923cd410b05af0dc7641aa6e2651e19392)
r1.2GAGGGCGGCTTCCACCCCGGCACCGGCCTGGCCGCCGATCGCCTCGTCGGCATGACGAAGCTCGC
|SOURCES={KEY=bf97e692...,fw,558357-558437}|ERRORS={}|SOURCE_1="CP007128.1
Gemmatimonadetes bacterium KBS708, complete genome"
(bf97e6923cd410b05af0dc7641aa6e2651e19392)
r2.1TGGAACAGCTCGTCGCGGGCTTCCTCGTAGGGCGTCGGGGTCGCGACAGCATCCCGTCGTCCGCG
|SOURCES={KEY=bf97e692...,bw,4893168-4893248}|ERRORS={}|SOURCE_1="CP007128.1
Gemmatimonadetes bacterium KBS708, complete genome"
(bf97e6923cd410b05af0dc7641aa6e2651e19392)
r2.2ACTAGATTGACGACGAA
|SOURCES={KEY=bf97e692...,fw,4892115-4892195}|ERRORS={76:T}|SOURCE_1="CP007128.1
Gemmatimonadetes bacterium KBS708, complete genome"
(bf97e6923cd410b05af0dc7641aa6e2651e19392)