[mira_talk] How do you call your ABI traces?

I recently have been wondering about my ABI tracefiles that I get back from the 
sequencing centre. I'm trying to find out why MIRA ditched the reads as debris. 
They were gap closure PCR sequences from genome template (I used the 
phred-generated ones in my assembly).

IBack in the '90s, I used to use pregap to call my traces because I used the 
Staden package for everything. When I sequenced my first genome in the old 
pre-NGS days, my bioinformatics team used phred/phrap/consed.  On the net, some 
people mentioned tracetuner (ex Paracel, now OSS), which also does the job.

Being curious about how differently each program manipulates the trace data, I 
made fastq files using all three programs from the same ABI tracefile.  In all 
3 cases, I used convert_project to convert the exp (pregap4) or 
fasta/fasta.qual files (phred and tracetuner) to fastq.


head -n4 pregap/PROJ.fastq 
@80301_F_B09
NNNNNNNNNNNTCNNNNNNGGNNANNGANTCCGGCACCCCGGTATTAATGTCGCCGCCGGATAACAACAGGACGCTTCCCCCCTCTTGCGCCACCTCTTTACGGATACTGTCCACCAGCGTTTTTTGCGCTGCCAGACCATATTCGCCATATTCGCTGCGCCAGAAGTGACCGTGGTGATCGTTGGTATGCAGGATAGTAATTTTATAGGTTTTATCTTTTTCGTAAGCCTGTGCAGGCTGAGTCGTCAGCGCGAACGCCGCCAGTAACGCCAGCGCCACACCCCGTTTCAAAAATTTCATCTTTCTCTCCCTGACTCAATATCAACCGCAGAAATTACCTTTCCTTGCAATAATAGACAAATATGTTTTCAGAATTGAGACTTCCTTCAAACACATTTCACAGGTATGTTAGGCAAGTAATAATTACACATCCTACTATCTCCAACATCGCATAAAATTTAAGTGACTTTCTATGGCCATGAGTGAACCAACCCAGCCGTTAGCCGGCGCGCCCGCAGCGGCCGCTAAAGCACGTACTTCGTTTGGTATTTTGGGCGCGATCAGTCTTTCCCATCTGCTGAACGATATGATCCAGTCGCTAATCTTAGCCANNNNNNCCCCTGTNGA
+
%%%%%%%%%%%&(%%%%%%))%%*%%--%/248?ABIHHGIHIKLKKKJJJJLLLLMLLLLKKLLLLLLMMMNNNNOOOOQOOOONNNNNNNNNNNNNNNOOOOONNNNNNNNNNNOOOOOQQQQQQQQQOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOQQQQQQQOOQOQQOOOOONNNNNNNNNNNNNNNNNNNNOOQQQQQQQQQQOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOONNOOOOOOOOOOOONOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOONNNNOOOOOOOOOOQQQQQQQQQQQQQQQQOQOOOOOOONNNNNNNNNNNNNNNNNONOOOOOOOOOOOOOOOOOOOOOOOOOONNNNNNNNNNNNNNNNNMNNNNNNNNNNNNNNOOOOOONNNNNNNNNNNNNMMNNNMMNNMMMMLMLLLLLLLLLLLLLLLKKJJJJJJIJJJJJKLLLLMMMMMMMMMMMMNNNNNNNNNNNNNNMMKKKHGFEEECBCBCBEFFHIJKJJKKKKKKKKKKJJIIJJJJJJIJJJJJJC<72/--%%%%%%*MMMMMM%MM


$ head -n4 traceTuner/PROJ.fastq 
@80301_F_B09.ab1 627 8 619
GTCCCAAGTCTCGCATCTGGAGACGGATTCCGGCACCCCGGTATTAATGTCGCCGCCGGATAACAACAGGACGCTTCCCCCCTCTTGCGCCACCTCTTTACGGATACTGTCCACCAGCGTTTTTTGCGCTGCCAGACCATATTCGCCATATTCGCTGCGCCAGAAGTGACCGTGGTGATCGTTGGTATGCAGGATAGTAATTTTATAGGTTTTATCTTTTTCGTAAGCCTGTGCAGGCTGAGTCGTCAGCGCGAACGCCGCCAGTAACGCCAGCGCCACACCCCGTTTCAAAAATTTCATCTTTCTCTCCCTGACTCAATATCAACCGCAGAAATTACCTTTCCTTGCAATAATAGACAAATATGTTTTCAGAATTGAGACTTCCTTCAAACACATTTCACAGGTATGTTAGGCAAGTAATAATTACACATCCTACTATCTCCAACATCGCATAAAATTTAAGTGACTTTCTATGGCCATGAGTGAACCAACCCAGCCGTTAGCCGGCGCGCCCGCAGCGGCCGCTAAAGCACGTACTTCGTTTGGTATTTTGGGCGCGATCAGTCTTTCCCATCTGCTGAACGATATGATCCAGTCGCTAATCTTAGCCATTTTCCCCCCTGTTGA
+
!**2.///6//*339==7A1134-/1217>7DIDDFEEEEE?>=FEDEEEEEEEEEEEEEEHFEEEEEDMMEEEEEEEEEEEEEEEDDEEEEEEEEEEEENDLDEEENDMEEDDEEDJDEEEEEEEEEEEKEEEEEIEEEEEEEEEEEEEEENEEEJEENEENEEEEEIEEEEIEEKEEKEKEEKEEEEEEEDDEEEEEDELHGEIEDCCEEEENEEKKEEEEEEEENEEGDEEEEDDEEEEGDEEEEEEEEEEJEMDEEEEEEEEEEGDNEEEEEIEEEEIEEEGEJEKEEEEEEENEEKEKEEEEEEFGEEEMDEEEKEEKEEEJEHEFEMEEEIGFEEEEDDEEDDDEEEKEEEEEEEEEEEINEEEFDEDEEEEEEDEEELLEEDDEDEEEEEEEEEEEDDEEEEEEEDDEEEEEEEEEEEEDDDDEEDDEFIEEEEEDDEEEEEDDDEEEEEEEEEEEDDEEEEEEEEEGEDDDEDEEDDEEEDDEDDEDEHCDEEEEDDDDDEDEDDCCCDDCCEJHJEEEEEEDDDDDELDEEDDEEEEEEEEEEEEEEEDCCECCDBBDEEEDDDEEEEDDEEIECCIFFDDEEJDGCCEDDEEEEEEEECCCE65**33>??<?EEECF


$ head -n4 phred_files/PROJ.fastq
@80301_F_B09.ab1
AGCCGCAAGGCTCGCATCCTGCGAATCGGATTCCGGCACCCCGGTATTAATGTCGCCGCCGGATAACAACAGGACGCTTCCCCCCTCTTGCGCCACCTCTTTACGGATACTGTCCACCAGCGTTTTTTGCGCTGCCAGACCATATTCGCCATATTCGCTGCGCCAGAAGTGACCGTGGTGATCGTTGGTATGCAGGATAGTAATTTTATAGGTTTTATCTTTTTCGTAAGCCTGTGCAGGCTGAGTCGTCAGCGCGAACGCCGCCAGTAACGCCAGCGCCACACCCCGTTTCAAAAATTTCATCTTTCTCTCCCTGACTCAATATCAACCGCAGAAATTACCTTTCCTTGCAATAATAGACAAATATGTTTTCAGAATTGAGACTTCCTTCAAACACATTTCACAGGTATGTTAGGCAAGTAATAATTACACATCCTACTATCTCCAACATCGCATAAAATTTAAGTGACTTTCTATGGCCATGAGTGAACCAACCCAGCCGTTAGCCGGCGCGCCCGCAGCGGCCGCTAAAGCACGTACTTCGTTTGGTATTTTGGGCGCGATCAGTCTTTCCCATCTGCTGAACGATATGATCCAGTCGCTAATCTTAGCCATTTACCCCCTGTTGAAAN
+
''''((.-0-1,*****5(('''))+24.))*-8A88:FF=JJEEEGPKSSSVZZZZ\ZZLPPPPeeeWSSSSSSeeeeeeeeeeeeeeeeeeeeeeeeeeZZZZZZZeeeeeeeeZZZZZ\\eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee\\ZZZ\\ee\\\eeee_______eeeeeeeeeeeeeeeeeeeee_______eeeeeeeeeeeee________eeeee_ee____eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee__eeeeeeeeee____eeeeeeeeeeeee___eeeeeeeeeeeeeeeeeeeee______eee_____eee___eeeeeeeeeee_______ee_______eeeeeeee________________e____ZZ\\\\\\\eeeeeeeeee\\\eeeeeee\\\\\\\\\\\\\eeeee\\\Z\Z\\\\\\Z\\\\\\\ZZWUZUUU\\\eeee\\e\\\\\\\\\\\eeeeeeeeeeeeee\\\PPLZZLLLP\\\ZZZ\\\\\\Z\\\WWW\\ZZZZZZQ\\\QQ\\\\\\\\QQP8;.0+0*+++44?-)))$!

Who do you trust?

John
--
You have received this mail because you are subscribed to the mira_talk mailing 
list. For information on how to subscribe or unsubscribe, please visit 
http://www.chevreux.org/mira_mailinglists.html

Other related posts: