atw: Friday joke on Saturday

Sorry about the time delay. WA is in another time zone etc., digest version at my end. We do things diff. here too. Here's a little something in response to Christine's plea.

National Institutes of Health

Human Genome Project scientists announced a significant breakthrough in cracking the genetic code today. They disclosed that they have solved the long-standing problem of why only a small fraction of the DNA strand is actually used by the cell to code for proteins, while the rest seems to be just unused "junk".

The crux of the discovery was the amino acid sequence:

ATGCATGGACTGATCTAGTCATGCTGACTGGTACATACCGAATCAGTACCATGGACATATACAGTAC
 GTTACCGTGACCTCAGTCAATGGCCATCTCGTGACTTCGATCTACTGAAATCCATGATCATAGCATG
 ATCAGTCCTACGTAGCATGCAATGCATGCATATAGCATATCACATTATACGACTACGTACATGACGT
 ACCGTAGTACATCAGG

which was found to decode to:

"this space intentionally left blank." 



Bill


Don't worry about that washing machine Michael (G) how about mice eating the wiring of a brand new fridge. ( and getting roasted on a capacitor) Its located 70km east of Perth and as you all know, Perth "stops" when you go up the hill to the east. Easier to get the repair guys from the locale. One day.

austechwriter Digest    Thu, 26 Jan 2006        Volume: 04  Issue: 025

In This Issue:
                Re: Why are deleted files not in the recycle bin?
                Re: deep linking into a roboinfo document
                Re: OT: English is such a marvelous language
                Re: OT: English is such a marvelous language
                Ahh, the Friday Afternoon blues
                Digression: Question for ASTC (Vic) Members
                OT: Re: Digression: Question for ASTC (Vic) Members


I am in Queensland. I don't know if you have the same TV ads as us, but if you did you would not dare get uppity about the odd joke at male expense. The advertisments should not even be legal, let alone long running. Pity us. We don't even get to laugh at Bob Catter - he is the "We do things differently here" (said with much chest puffing pride and posturing) Norm.

Now at least two of those sentences are challenging enough to keep you working at them for a while.

Christine

PS  Where are the Friday jokes?  That's something men are good at.  ;-)


--
Dr Bill Parker
Editor  "Solar Progress"
The ANZSES Journal
Box 322 Mount Lawley 6929 Australia
Phone 08 9272 9955   0403 583 676
email: renew@xxxxxxxxxxxxxx
http://www.anzses.org/
http://www.solarhouseday.com

Other related posts: